Classification of Mouse Transcription Factors
- Draft September 22, 2014 -
 
This classification is the working version that comprises only murine transcription factors (TFs) that have human orthologs, with few exceptions. In particular many mouse-specific TFs are still missing in Class 2.3 (C2H2 zinc finger factors). As for the classification of the human TFs, it may be subject to occasional changes, suggested for discussion.

Symbols / links:
Class description: TRANSFAC® class descriptions; Class description: new class descriptions; Further information: additional information about the class and its members (see below);
UniProt: Link to reviewed mouse entries UniProt; UniProt: Link to unreviewed mouse entries UniProt; UniProt: Link to reviewed human UniProt entries; UniProt /UniProt: Link to reviewed/unreviewed rat UniProt entries, resp.
"Txxxxx": TRANSFAC accession numbers, mostly linked to BIOBASE Knowledge Library (BKL); "T" only provides a link to a BKL entry that has no TRANSFAC accession yet.
PDB: Link to PDB; preferably to a complex of the corresponding DNA-binding domain (DBD) with DNA, provisionally the DBD alone, referring to the human or a mammalian ortholog; for a few excpetions, illustrative structures of fungal homologs are linked.
Additional information:
The question mark in the Class title line links to the class description, the sequences of the manually adjusted DNA-binding domains of this respective class and their alignments, logo plots and, whenever relevant, further information like dimerization matrices etc.
DNA sequence patterns:
The DNA sequences assigned to many families or subfamilies represent typical or proven individual binding sequences for (some of) the domains in the respective taxon. They should not be taken as a consensus, and they are not suitable for predicting potential TF binding sites.
The logo plots after many TF genera have been derived from the profile library published by the group of J. Taipale at Karolinska Institute (Jolma et al., Cell 152, 327-339 (2013); PubMed 23332764) and were kindly provided by P. Stegmaier (geneXplain GmbH). Each of these plots is linked to an htm file with all matrices for this factor, human and mouse, that were given by Jolma et al., one of them being selected for the logo plot. The individual matrices are given a unique ID, comprising the gene symbol of the factor and an alphanumeric specification of the respective matrix, which may be either a consecutive number, or may have an additional "m" to indicate monomeric factor binding mode, "d" for dimers, or "dd" for dimers of dimers bound to the respective sequence patterns. For further explanation of the information provided with each matrix, kindly refer to the original publication.
Citation:
Wingender, E., Schoeps, T. and Dönitz, J.: TFClass: An expandable hierarchical classification of human transcription factors. Nucleic Acids Res. 41, D165-D170 (2013). doi: 10.1093/nar/gks1123 (Link)
 
1 Superclass: Basic domains TRANSFAC class description
  1.1 Class: Basic leucine zipper factors (bZIP) TRANSFAC class description Further information
  1.1.1 Family: Jun-related factors TGAGTCA  
  1.1.1.1 Subfamily: Jun factors TGAGTCA  
  1.1.1.1.1 c-Jun   UniProt T00131 UniProt UniProt PDB
  1.1.1.1.2 JunB   UniProt T00436 UniProt UniProt  
  1.1.1.1.3 JunD   UniProt T00437 UniProt UniProt  
  1.1.1.2 Subfamily: NF-E2-like factors GCTGAGTCA  
  1.1.1.2.1 NF-E2 p45 UniProt T01441 UniProt UniProt  
  1.1.1.2.2 NF-E2L1 (NRF1)   UniProt T02203 UniProt UniProt  
  1.1.1.2.2.1 NF-E2L1, isoform 1 (Nrf1a)   UniProt T09558  
  1.1.1.2.2.2 NF-E2L1, isoform 2 (Nrf1b)   UniProt T28874  
  1.1.1.2.2.3 NF-E2L1, isoform 3 (short)   UniProt T13800  
  1.1.1.2.3 NF-E2L2 (NRF2)   UniProt T04938 UniProt UniProt  
  1.1.1.2.4 NF-E2L3 (NRF3)   UniProt T05710 UniProt UniProt  
  1.1.1.2.5 BACH1   UniProt T04793 UniProt UniProt  
  1.1.1.2.6 BACH2   UniProt T04792 UniProt UniProt  
  1.1.1.3 Subfamily: ATF-2-like factors TGACGTCA  
  1.1.1.3.1 ATF-2   UniProt T10238 UniProt UniProt PDB
  1.1.1.3.1.1 ATF-2, isoform 1   UniProt T02056  
  1.1.1.3.1.2 ATF-2, isoform 2   UniProt T01017  
  1.1.1.3.1.3 ATF-2, isoform 3   UniProt T02036  
  1.1.1.3.2 ATF-7 UniProt T19847 UniProt UniProt  
  1.1.1.3.3 CREB-5 (CRE-BPa) UniProt T18881 UniProt UniProt  
  1.1.1.3.3.1 CREB-5, isoform 1   UniProt T18880  
  1.1.1.3.3.2 CREB-5, isoform 2   UniProt T18882  
  1.1.2 Family: Fos-related factors (TGAGTCA)  
  1.1.2.1 Subfamily: Fos factors (TGAGTCA)  
  1.1.2.1.1 c-Fos   UniProt T00122 UniProt UniProt PDB
  1.1.2.1.2 FosB   UniProt T10574 UniProt UniProt  
  1.1.2.1.3 Fra-1   UniProt T00292 UniProt UniProt  
  1.1.2.1.4 Fra-2   UniProt T02199 UniProt UniProt  
  1.1.2.1.4.1 Fra-2, isoform 1   UniProt T08535  
  1.1.2.1.4.2 Fra-2, isoform 2   UniProt T26121  
  1.1.2.2 Subfamily: ATF-3-like factors TGACGTCA  
  1.1.2.2.1 ATF-3   UniProt T08977 UniProt UniProt  
  1.1.2.2.1.1 ATF-3, isoform 1   UniProt T04850  
  1.1.2.2.1.2 ATF-3, isoform 2 (ATF-3b)     T08976  
  1.1.2.2.2 JDP-2 UniProt T19034 UniProt UniProt  
  1.1.3 Family: Maf-related factors TGCTGACTCAGCA  
  1.1.3.1 Subfamily: Large Maf factors TGCTGACTCAGCA  
  1.1.3.1.1 c-Maf   UniProt T01432 UniProt UniProt  
  1.1.3.1.1.1 c-Maf, isoform 1   UniProt T09212  
  1.1.3.1.1.2 c-Maf, isoform 2   UniProt T26181  
  1.1.3.1.1.3 c-Maf, isoform 3   UniProt T26182  
  1.1.3.1.2 MafA   UniProt T08226 UniProt UniProt  
  1.1.3.1.3 MafB UniProt T01439 UniProt UniProt PDB
  1.1.3.1.4 Nrl UniProt T01438 UniProt UniProt  
  1.1.3.2 Subfamily: Small Maf factors TGCTGACTCAGCA  
  1.1.3.2.1 MafF UniProt T05751 UniProt UniProt  
  1.1.3.2.2 MafG UniProt T05750 UniProt UniProt  
  1.1.3.2.3 MafK UniProt T01435 UniProt UniProt  
  1.1.4 Family: B-ATF-related factors TGAGTCA  
  1.1.4.0.1 B-ATF   UniProt T19854 UniProt UniProt  
  1.1.4.0.2 B-ATF-2   UniProt T UniProt UniProt  
  1.1.4.0.2.1 B-ATF-2, isoform 1   UniProt T  
  1.1.4.0.2.2 B-ATF-2, isoform 2   UniProt T  
  1.1.4.0.3 B-ATF-3 UniProt T18807 UniProt UniProt  
  1.1.5 Family: XBP-1-related factors GGATGACGTGTACA  
  1.1.5.0.1 XBP-1 UniProt T08152 UniProt UniProt  
  1.1.5.0.1.1 XBP-1U   UniProt T19362  
  1.1.5.0.1.2 XBP-1S   UniProt T11222  
  1.1.6 Family: ATF-4-related factors TGACGTCA  
  1.1.6.0.1 ATF-4 UniProt T08444 UniProt UniProt  
  1.1.6.0.2 ATF-5   UniProt T16632 UniProt UniProt  
  1.1.7 Family: CREB-related factors TGACGTCA  
  1.1.7.1 Subfamily: CREB-like factors TGACGTCA  
  1.1.7.1.1 CREB (CREB-1)   UniProt T02280 UniProt UniProt PDB
  1.1.7.1.1.1 CREB, isoform 1 (CREBα)   UniProt T00989  
  1.1.7.1.1.2 CREB, isoform 2 (CREBΔ)   UniProt T01311  
  1.1.7.1.1.3 CREB, isoform 3 (CREBβ)     T02361  
  1.1.7.1.1.4 CREB, isoform 4 (CREBω)     T01312  
  1.1.7.1.2 ATF-1   UniProt T01304 UniProt UniProt  
  1.1.7.1.3 CREM   UniProt T10306 UniProt UniProt  
  1.1.7.1.3.1 CREM-τ, isoform 1 (CREM-BCEFGγHIβ)   UniProt T01320  
  1.1.7.1.3.2 CREM-α, isoform 2   UniProt T01314  
  1.1.7.1.3.3 CREM-β, isoform 3   UniProt T01315  
  1.1.7.1.3.4 CREM-γ, isoform 4   UniProt T01316  
  1.1.7.1.3.5 CREM-ταγ, isoform 5   UniProt T26061  
  1.1.7.1.3.6 CREM-τ2α, isoform 6   UniProt T26062  
  1.1.7.1.3.7 CREM-τ1α, isoform 7   UniProt T26063  
  1.1.7.1.3.8 CREM-τ1αγ, isoform 8   UniProt T26064  
  1.1.7.1.3.9 CREM-τ1γ, isoform 9   UniProt T26065  
  1.1.7.1.3.10 CREM-αγ, isoform 10   UniProt T26376  
  1.1.7.2 Subfamily: CREB-3-like factors TGACGTCA  
  1.1.7.2.1 CREB-3 (Luman, LZIP) UniProt T18876 UniProt UniProtF  
  1.1.7.2.1.1 CREB-3, isoform 1 (LZIP-1)   UniProt T18875  
  1.1.7.2.1.2 LZIP, isoform 2 (LZIP-2)   UniProt T18874  
  1.1.7.2.2 CREB-3L1 (OASIS) UniProt T18855 UniProt UniProt  
  1.1.7.2.2.1 CREB-3L1, isoform 1   UniProt T18854  
  1.1.7.2.2.2 CREB-3L1, isoform 2   UniProt T18853  
  1.1.7.2.3 CREB-3L2 UniProt T15600 UniProt UniProt  
  1.1.7.2.4 CREB-3L3 (CREB-H)   UniProt T18861 UniProt UniProt  
  1.1.7.2.5 CREB-3L4 (AIBZIP)   UniProt T18868 UniProt UniProt  
  1.1.7.2.5.1 CREB-3L4, isoform 1 (Tisp40β)   UniProt T18866  
  1.1.7.2.5.2 CREB-3L4, isoform 2 (Tisp40α)   UniProt T18867  
  1.1.7.3 Subfamily: ATF-6 factors TGACGTGG  
  1.1.7.3.1 ATF-6α   UniProt T26785 UniProt UniProt  
  1.1.7.3.2 ATF-6β   UniProt T18795 UniProt UniProt  
  1.1.7.4 Subfamily: CREBZF-like factors TGACGTCA  
  1.1.7.4.1 CREBZF (Zhangfei, ZF)   UniProt T UniProt UniProt  
  1.1.7.5 Subfamily: CREBL2-like factors TGACGTCA  
  1.1.7.5.1 CREBL2   UniProt T19897 UniProt UniProt  
  1.1.8 Family: C/EBP-related ATTGCGCAAT  
  1.1.8.1 Subfamily: C/EBP ATTGCGCAAT  
  1.1.8.1.1 C/EBPα   UniProt T08464 UniProt UniProt PDB
  1.1.8.1.2 C/EBPβ (NF-IL6-1) UniProt T09409 UniProt UniProt PDB
  1.1.8.1.2.1 C/EBPβ, isoform 1 (C/EBPβ-FL)   UniProt T00017  
  1.1.8.1.2.2 C/EBPβ, isoform 2 (C/EBPβ-LAP)   UniProt    
  1.1.8.1.2.3 C/EBPβ, isoform 3 (C/EBPβ-LIP)   UniProt T02360  
  1.1.8.1.3 C/EBPγ UniProt T00216 UniProt UniProt  
  1.1.8.1.4 C/EBPδ UniProt T01114 UniProt UniProt  
  1.1.8.1.5 C/EBPε UniProt T16653 UniProt UniProt  
  1.1.8.1.6 DDIT3 (CHOP-10)   UniProt T00127 UniProt UniProt  
  1.1.8.2 Subfamily: PAR factors TTATGCAA  
  1.1.8.2.1 DBP UniProt T05865 UniProt UniProt  
  1.1.8.2.2 HLF UniProt T19989 UniProt UniProt  
  1.1.8.2.3 TEF UniProt T10579 UniProt UniProt  
  1.1.8.2.3.1 TEF-α   UniProt T10575  
  1.1.8.2.3.2 TEF-β   UniProt T10576  
  1.1.8.2.3.3 TEF, isoform 2   UniProt T10577  
  1.1.8.2.4 NF-IL3 (E4BP4) UniProt T16464 UniProt UniProt  
  1.1.0 Family: ZIP only    
  1.1.0.1 Subfamily: TSC22    
  1.1.0.1.1 TSC22D1 (TSC-22, Cerebral protein 2)   UniProt T27854 UniProt UniProt  
  1.1.0.1.1.1 TSC22D1, isoform 1   UniProt T27936  
  1.1.0.1.1.2 TSC22D1, isoform 2   UniProt T27360  
  1.1.0.1.1.3 TSC22D1, isoform 3   UniProt T27937  
  1.1.0.1.2 TSC22D2 (TILZ4)   UniProt T UniProt UniProt  
  1.1.0.1.3 TSC22D3 (DSIPI, GILZ)   UniProt T22155 UniProt UniProt  
  1.1.0.1.3.1 TSC22D3, isoform 1 (Tilz3b)   UniProt T25737  
  1.1.0.1.3.2 TSC22D3, isoform 2 (Tilz3a)   UniProt T25738  
  1.1.0.1.3.3 TSC22D3, isoform 3 (Tilz3c)   UniProt T25739  
  1.1.0.1.4 TSC22D4 (TILZ2)   UniProt T UniProt UniProt  
  1.1.0.2 Subfamily: UTF    
  1.1.0.2.1 UTF1   UniProt T09523 UniProt UniProt  
  1.1.0.2.1.1 UTF1, isoform 1   UniProt T08886  
  1.1.0.2.1.2 UTF1, isoform 2   UniProt T26349  
  1.2 Class: Basic helix-loop-helix factors (bHLH) TRANSFAC class description Further information
  1.2.1 Family: E2A-related factors CAGGTG  
  1.2.1.0.1 E2A (TCF-3, ITF-1) UniProt T10541 UniProt UniProt PDB
  1.2.1.0.1.1 E12 (PAN-2)   UniProt T01786  
  1.2.1.0.1.2 E47 (PAN-1)   UniProt T01788  
  1.2.1.0.2 SEF2 (E2-2, TCF-4, ITF-2, MITF) UniProt T19028 UniProt UniProt  
  1.2.1.0.2.1 SEF2, isoform 1 (MITF-2A)   UniProt T19025  
  1.2.1.0.2.2 SEF2, isoform 2 (MITF-2B)   UniProt T19027  
  1.2.1.0.2.3 SEF2, isoform 3 (MITF-2BΔ)   UniProt T19026  
  1.2.1.0.3 HTF-4 (TCF-12, HEB)   UniProt T09513 UniProt UniProt  
  1.2.1.0.3.1 HTF-4a, isoform 1 (ME1A; α)   UniProt T01496  
  1.2.1.0.3.2 HTF-4b, isoform 2 (ME1B; γ)   UniProt T01497  
  1.2.2 Family: MyoD / ASC-related factors CAGGTG  
  1.2.2.1 Subfamily: Myogenic transcription factors    
  1.2.2.1.1 MyoD (Myod1)   UniProt T00506 UniProt UniProt PDB
  1.2.2.1.2 Myogenin (Myog, Myf-4)   UniProt T00528 UniProt UniProt  
  1.2.2.1.3 Myf-5   UniProt T01534 UniProt UniProt  
  1.2.2.1.4 Myf-6 (MRF4) UniProt T16555 UniProt UniProt  
  1.2.2.2 Subfamily: Achaete-Scute-like factors    
  1.2.2.2.1 ASH-1 (ASCL1)   UniProt T01619 UniProt UniProt  
  1.2.2.2.2 ASH-2 (ASCL2) UniProt T16775 UniProt UniProt  
  1.2.2.2.3 ASH-3 (ASCL3)   UniProt T19843 UniProt UniProt  
  1.2.2.2.4 ASH-4 (ASCL4)   UniProt T UniProt UniProt  
  1.2.2.2.5 ASH-5 (ASCL5)   UniProt T UniProt UniProt  
  1.2.3 Family: Tal-related factors CAGCTG  
  1.2.3.1 Subfamily: Tal / HEN-like factors CAGCTG  
  1.2.3.1.1 Tal-1 (SCL, TCL-5)   UniProt T16151 UniProt UniProt  
  1.2.3.1.2 Tal-2   UniProt T01631 UniProt UniProt  
  1.2.3.1.3 Lyl-1   UniProt T UniProt UniProt  
  1.2.3.1.4 HEN1 (NSCL-1, NHLH1) UniProt T01655 UniProt UniProt  
  1.2.3.1.5 HEN2 (NSCL-2, NHLH2)   UniProt T01657 UniProt UniProt  
  1.2.3.2 Subfamily: Twist-like factors CGTCTG  
  1.2.3.2.1 Twist-1 (H-Twist, M-Twist)   UniProt T01635 UniProt UniProt  
  1.2.3.2.2 Twist-2 (Dermo-1)   UniProt T02404 UniProt UniProt  
  1.2.3.2.3 HAND-1 (eHAND, Th1)   UniProt T01569 UniProt UniProt  
  1.2.3.2.4 HAND-2 (dHAND)   UniProt T04370 UniProt UniProt  
  1.2.3.2.5 bHLH-EC2 (TCF-15)   UniProt T01613 UniProt UniProt  
  1.2.3.2.6 Scx   UniProt T19232 UniProt UniProt  
  1.2.3.2.7 PTF-1a   UniProt T01227 UniProt UniProt  
  1.2.3.2.8 FIGα UniProt T15614 UniProt UniProt  
  1.2.3.3 Subfamily: Mesp-like factors    
  1.2.3.3.1 Mesp-1 UniProt T20013 UniProt UniProt  
  1.2.3.3.2 Mesp-2   UniProt T06095 UniProt UniProt  
  1.2.3.3.3 TCF-23   UniProt T UniProt UniProt  
  1.2.3.3.4 ABF-1 (Musculin, MyoR, MSC) UniProt T05193 UniProt UniProt  
  1.2.3.3.5 Pod-1 (TCF-21) UniProt T19300 UniProt UniProt  
  1.2.3.3.6 Mesogenin-1 (MSGN1)   UniProt T20026 UniProt UniProt  
  1.2.3.4 Subfamily: Neurogenin / Atonal-like factors CAGCTG  
  1.2.3.4.1 NeuroD1   UniProt T01626 UniProt UniProt PDB
  1.2.3.4.2 NeuroD2 UniProt T17539 UniProt UniProt  
  1.2.3.4.3 NeuroD4 (ATH-3)   UniProt T20046 UniProt UniProt  
  1.2.3.4.4 NeuroD6 (ATH-2)   UniProt T01629 UniProt UniProt  
  1.2.3.4.5 NGN-1 (NeuroD3)   UniProt T08093 UniProt UniProt  
  1.2.3.4.6 NGN-2 (Atoh4, NeuroG2) UniProt T08094 UniProt UniProt  
  1.2.3.4.7 NGN-3 (Atoh5, NeuroG3)   UniProt T06058 UniProt UniProt  
  1.2.3.4.8 ATH-1 (ATOH-1) UniProt T01668 UniProt UniProt  
  1.2.3.4.9 ATH-5 (ATOH-7)   UniProt T18802 UniProt UniProt  
  1.2.3.4.10 ATH-6 (ATOH-8)   UniProt T19852 UniProt UniProt  
  1.2.3.4.11 bHLHe22 (Beta3) UniProt T UniProt UniProt  
  1.2.3.4.12 bHLHe23 UniProt T UniProt UniProt  
  1.2.3.4.13 OLIGO1 UniProt T05853 UniProt UniProt  
  1.2.3.4.14 OLIGO2 UniProt T05852 UniProt UniProt  
  1.2.3.4.15 OLIGO3 UniProt T20054 UniProt UniProt  
  1.2.3.4.16 MIST1 (bHLHa15) UniProt T UniProt UniProt  
  1.2.3.4.17 Fer3L (Ferd3L)   UniProt T19925 UniProt UniProt  
  1.2.3.5 Subfamily: bHLHa9-like factors    
  1.2.3.5.1 bHLHa9   UniProt T UniProt UniProt  
  1.2.4 Family: Hairy-related factors CACGAG  
  1.2.4.1 Subfamily: Hairy-like factors CACGAG  
  1.2.4.1.1 HES-1   UniProt T09896 UniProt UniProt  
  1.2.4.1.2 HES-2   UniProt T UniProt UniProt  
  1.2.4.1.3 HES-3   UniProt T05081 UniProt UniProt  
  1.2.4.1.5 HES-5 UniProt T18965 UniProt UniProt  
  1.2.4.1.6 HES-6   UniProt T27825 UniProt UniProt  
  1.2.4.1.7 HES-7 UniProt T19984 UniProt UniProt  
  1.2.4.1.8 HEY-1 UniProt T05077 UniProt UniProt  
  1.2.4.1.9 HEY-2 UniProt T05083 UniProt UniProt  
  1.2.4.1.10 HEYL (HRT3)   UniProt T05082 UniProt UniProt  
  1.2.4.1.11 HELT   UniProt T16559 UniProt UniProt  
  1.2.4.1.12 DEC1 (STRA-13, bHLHb2) UniProt T02327 UniProt UniProt  
  1.2.4.1.13 DEC2 (bHLHb3) UniProt T05845 UniProt UniProt  
  1.2.5 Family: PAS domain factors CACGC  
  1.2.5.1 Subfamily: Ahr-like factors CACGC  
  1.2.5.1.1 AhR   UniProt T00194 UniProt UniProt  
  1.2.5.1.2 AhRR   UniProt T18746 UniProt UniProt  
  1.2.5.1.2.1 AhRR, isoform 1   UniProt T05429  
  1.2.5.1.2.2 AhRR, isoform 2   UniProt T26012  
  1.2.5.1.2.3 AhRR, isoform 3   UniProt T26013  
  1.2.5.1.3 SIM1   UniProt T20110 UniProt UniProt  
  1.2.5.1.4 SIM2   UniProt T19235 UniProt UniProt  
  1.2.5.1.5 HIF-1α   UniProt T04666 UniProt UniProt  
  1.2.5.1.5.1 HIF-1α, isoform 1   UniProt T18977  
  1.2.5.1.5.2 HIF-1α, isoform 2   UniProt T26140  
  1.2.5.1.6 HIF-3α   UniProt T18986 UniProt UniProt  
  1.2.5.1.6.1 HIF-3α, isoform 1   UniProt T18988  
  1.2.5.1.6.2 HIF-3α, isoform 2   UniProt T18987  
  1.2.5.1.7 EPAS-1   UniProt T02719 UniProt UniProt  
  1.2.5.1.8 NPAS-1   UniProt T05876 UniProt UniProt  
  1.2.5.1.9 NPAS-3   UniProt T05878 UniProt UniProtF  
  1.2.5.2 Subfamily: Arnt-like factors CACGTG  
  1.2.5.2.1 Arnt (HIF-1β)   UniProt T01797 UniProt UniProt  
  1.2.5.2.1.1 Arnt long, isoform 1   UniProt T10458  
  1.2.5.2.1.2 Arnt short, isoform 2   UniProt T18790  
  1.2.5.2.2 Arnt-2   UniProt T18787 UniProt UniProt  
  1.2.5.2.2.1 Arnt-2, isoform 1   UniProt T18785  
  1.2.5.2.2.2 Arnt-2, isoform 2   UniProt T18786  
  1.2.5.2.3 ArntL (Bmal1) UniProt T05869 UniProt UniProt  
  1.2.5.2.3.1 ArntL, isoform 1 (b')   UniProt T10228  
  1.2.5.2.3.2 ArntL, isoform 2 (b)   UniProt T18818  
  1.2.5.2.3.3 ArntL, isoform 3   UniProt T18819  
  1.2.5.2.3.4 ArntL, isoform 4   UniProt T18820  
  1.2.5.2.3.5 ArntL, isoform 5 (g')   UniProt T18821  
  1.2.5.2.4 ArntL2 (Bmal2)   UniProt T05874 UniProt UniProt  
  1.2.5.2.4.1 ArntL2, isoform 1 (Bmal2a)   UniProt T11140  
  1.2.5.2.4.2 ArntL2, isoform 2 (Bmal2b)   UniProt T26045  
  1.2.5.2.5 CLOCK UniProt T05868 UniProt UniProt  
  1.2.5.2.5.1 CLOCK, isoform Long   UniProt T10259  
  1.2.5.2.5.2 CLOCK, isoform Short   UniProt T18843  
  1.2.5.2.6 NPAS-2   UniProt T05877 UniProt UniProt  
  1.2.5.3 Subfamily: NCoA factors    
  1.2.5.3.1 NCoA-1 (SRC-1)   UniProt T04639 UniProt UniProt  
  1.2.5.3.1.1 NCoA-1, isoform 1 (SRC-1A)   UniProt T25725  
  1.2.5.3.1.2 NCoA-1, isoform 2 (SRC-1E)   UniProt T09181  
  1.2.5.3.1.3 NCoA-1, isoform 3   UniProt T26206  
  1.2.5.3.1.4 NCoA-1, isoform 4   UniProt T26207  
  1.2.5.3.2 NCoA-2   UniProt T02482 UniProt UniProt  
  1.2.5.3.3 NCoA-3   UniProt T04638 UniProt UniProt  
  1.2.5.4 Subfamily: NPAS-4 CACGA  
  1.2.5.4.1 NPAS-4   UniProt T UniProt UniProt  
  1.2.5.5 Subfamily: SOHLH-like factors    
  1.2.5.5.1 SOHLH1 (TEB2)   UniProt T20117 UniProt UniProt  
  1.2.5.5.2 SOHLH2 (TEB1)   UniProt T19246 UniProt UniProt  
  1.2.5.5.3 TCFL5 (Cha, E2BP-1)   UniProt T17742 UniProt UniProtF  
  1.2.6 Family: bHLH-ZIP factors CACATG  
  1.2.6.1 Subfamily: TFE3-like factors CACATG  
  1.2.6.1.1 TFE3 (TFEA) UniProt T09192 UniProt UniProt  
  1.2.6.1.1.1 TFE3, isoform 1   UniProt T19333  
  1.2.6.1.1.2 TFE3, isoform 2   UniProt T26336  
  1.2.6.1.1.3 TFE3, isoform 3   UniProt T26337  
  1.2.6.1.1.4 TFE3, isoform 4   UniProt T26338  
  1.2.6.1.2 TFEB UniProt T06082 UniProt UniProt  
  1.2.6.1.3 TFEC UniProt T14666 UniProt UniProt  
  1.2.6.1.4 MiTF   UniProt T01554 UniProt UniProt  
  1.2.6.1.4.1 MiTF, isoform A   UniProt T19067  
  1.2.6.1.4.2 MiTF, isoform A1   UniProt T19068  
  1.2.6.1.4.3 MiTF, isoform A2   UniProt T19066  
  1.2.6.1.4.4 MiTF, isoform H   UniProt T19065  
  1.2.6.1.4.5 MiTF, isoform H1   UniProt T19069  
  1.2.6.1.4.6 MiTF, isoform H2   UniProt T19070  
  1.2.6.1.4.7 MiTF, isoform H3   UniProt T19071  
  1.2.6.1.4.8 MiTF, isoform M   UniProt T09287  
  1.2.6.1.4.9 MiTF, isoform M1   UniProt T19072  
  1.2.6.2 Subfamily: USF factors CACGTG  
  1.2.6.2.1 USF-1 UniProt T00877 UniProt UniProt PDB
  1.2.6.2.2 USF-2   UniProt T01555 UniProt UniProt  
  1.2.6.2.2.1 USF-2A   UniProt T08315  
  1.2.6.2.2.2 USF-2B   UniProt T11000  
  1.2.6.3 Subfamily: SREBP factors ATCACCCCAC  
  1.2.6.3.1 SREBP-1 (SREBF1) UniProt T10488 UniProt UniProt PDB
  1.2.6.3.1.1 SREBP-1A   UniProt T15263  
  1.2.6.3.1.2 SREBP-1A-W42   UniProt T26305  
  1.2.6.3.1.3 SREBP-1C   UniProt T08890  
  1.2.6.3.1.4 SREBP-1C-W42   UniProt T26306  
  1.2.6.3.2 SREBP-2 (SREBF2) UniProt T15631 UniProt UniProt  
  1.2.6.3.2.1 SREBP-2, isoform 1   UniProt T19272  
  1.2.6.3.2.2 SREBP-2, isoform 2   UniProt T26307  
  1.2.6.4 Subfamily: AP-4 CAGCTG  
  1.2.6.4.1 AP-4 UniProt T16526 UniProt UniProt  
  1.2.6.5 Subfamily: Myc / Max factors CACGTG  
  1.2.6.5.1 c-Myc   UniProt T00143 UniProt UniProt PDB
  1.2.6.5.2 N-Myc   UniProt T01445 UniProt UniProt  
  1.2.6.5.3 L-Myc-1   UniProt T02387 UniProt UniProt  
  1.2.6.5.5 Max UniProt T16608 UniProt UniProt PDB
  1.2.6.5.6 B-Myc   UniProt T10695   UniProt  
  1.2.6.6 Subfamily: Mondo-like factors CACGTG  
  1.2.6.6.1 Mlx (Tcfl4) UniProt T05123 UniProt UniProt  
  1.2.6.6.1.1 Mlxα   UniProt T19092  
  1.2.6.6.1.2 Mlxβ   UniProt T08952  
  1.2.6.6.1.3 Mlxγ   UniProt T19093  
  1.2.6.6.2 MondoA (Mlx-IP)   UniProt T05125 UniProt UniProt  
  1.2.6.6.2.1 Mlx-IP, isoform 1   UniProt T18651  
  1.2.6.6.2.2 Mlx-IP, isoform 2   UniProt T18652  
  1.2.6.6.3 MondoB (Mlx-IPL, WS-bHLH) UniProt T05122 UniProt UniProt  
  1.2.6.6.3.1 Mlx-IPL, isoform 1 (ζ)   UniProt T14593  
  1.2.6.6.3.2 Mlx-IPL, isoform 2 (ϑ)   UniProt T26195  
  1.2.6.6.3.3 Mlx-IPL, isoform 3 (ι)   UniProt T26196  
  1.2.6.6.3.4 Mlx-IPL, isoform 4 (κ)   UniProt T26197  
  1.2.6.6.3.5 Mlx-IPL, isoform 5 (η)   UniProt T26198  
  1.2.6.7 Subfamily: Mad-like factors CACGTG  
  1.2.6.7.1 Mad1 (MXD1)   UniProt T02390 UniProt UniProt PDB
  1.2.6.7.2 Mad3 (MXD3)   UniProt T02391 UniProt UniProt  
  1.2.6.7.3 Mad4 (MXD4)   UniProt T02392 UniProt UniProt  
  1.2.6.7.4 Mad5 (MGA) = 6.5.5.0.2   UniProt T03940 UniProt UniProt  
  1.2.6.7.4.1 Mad5, isoform 1   UniProt T14744  
  1.2.6.7.4.2 Mad5, isoform 2   UniProt T26191  
  1.2.6.7.4.3 Mad5, isoform 3   UniProt T26192  
  1.2.6.7.4.4 Mad5, isoform 4   UniProt T26193  
  1.2.6.7.5 Mxi-1   UniProt T09074 UniProt UniProt  
  1.2.6.7.5.1 Mxi-1, isoform 1 (long)   UniProt T09075  
  1.2.6.7.5.2 Mxi-1, isoform 2 (short)   UniProt T09076  
  1.2.6.7.6 Mnt UniProt T03269 UniProt UniProtF  
  1.2.8 Family: HLH domain only    
  1.2.8.0.1 Id1   UniProt T00403 UniProt UniProt  
  1.2.8.0.1.1 Id1, isoform Long   UniProt T25726  
  1.2.8.0.1.2 Id1, isoform Short   UniProt T09185  
  1.2.8.0.2 Id2   UniProt T00404 UniProt UniProt  
  1.2.8.0.3 Id3   UniProt T00367 UniProt UniProt  
  1.2.8.0.4 Id4 UniProt T01658 UniProt UniProt  
  1.3 Class: Basic helix-span-helix factors (bHSH) TRANSFAC class description Further information
  1.3.1 Family: AP-2 GCCTGAGGC  
  1.3.1.0.1 AP-2α UniProt T10025 UniProt UniProt  
  1.3.1.0.1.1 AP-2α, isoform 1   UniProt T00033  
  1.3.1.0.1.2 AP-2α, isoform 2   UniProt T02488  
  1.3.1.0.1.3 AP-2α, isoform 3   UniProt T02489  
  1.3.1.0.1.4 AP-2α, isoform 4   UniProt T02490  
  1.3.1.0.2 AP-2β UniProt T02469 UniProt UniProt  
  1.3.1.0.3 AP-2γ UniProt T02470 UniProt UniProt  
  1.3.1.0.4 AP-2δ   UniProt T06431 UniProt UniProt  
  1.3.1.0.5 AP-2ε   UniProt T16752 UniProt UniProt  

2 Superclass: Zinc-coordinating DNA-binding domains TRANSFAC class description
  2.1 Class: Nuclear receptors with C4 zinc fingers TRANSFAC class description Further information
  2.1.1 Family: Steroid hormone receptors (NR3)    
  2.1.1.1 Subfamily: GR-like receptors (NR3C) AGAACATGATGTTCT  
  2.1.1.1.1 Glucocorticoid receptor (GR) (NR3C1) UniProt T00335 UniProt UniProt PDB
  2.1.1.1.1.1 GR, isoform 1 (A, 1-A)   UniProt T08555  
  2.1.1.1.1.2 GR, isoform 2 (B, 2-A)   UniProt T18951  
  2.1.1.1.1.3 GR, isoform 1-B   UniProt    
  2.1.1.1.1.4 GR, isoform 2-B   UniProt    
  2.1.1.1.2 Mineralocorticoid receptor (MR) (NR3C2) UniProt T17766 UniProt UniProt  
  2.1.1.1.3 Progesterone receptor (PR) (NR3C3)   UniProt T04680 UniProt UniProt PDB
  2.1.1.1.4 Androgen receptor (AR) (NR3C4) UniProt T00041 UniProt UniProt PDB
  2.1.1.2 Subfamily: ER-like receptors (NR3A&B) AGGTCACAGTGACCT  
  2.1.1.2.1 Estrogen receptor α (ERα) (ESR1, NR3A1) UniProt T00259 UniProt UniProt PDB
  2.1.1.2.2 Estrogen receptor β (ERβ) (NR3A2)   UniProt T17427 UniProt UniProt  
  2.1.1.2.2.1 ERβ1, isoform 1   UniProt T18909  
  2.1.1.2.2.2 ERβ2, isoform 2   UniProt T18910  
  2.1.1.2.2.3 ERβ2A, isoform 3 (5A)   UniProt T18912  
  2.1.1.2.2.4 ERβ3, isoform 4   UniProt T26417  
  2.1.1.2.2.5 ERβ4, isoform 5   UniProt T26418  
  2.1.1.2.3 ERR1 (ERRα, ESRRA) (NR3B1) UniProt T04849 UniProt UniProt  
  2.1.1.2.4 ERR2 (ERRβ, ESRRB) (NR3B2) UniProt T06175 UniProt UniProt PDB
  2.1.1.2.5 ERR3 (ERRγ, ESRRG) (NR3B3) UniProt T14585 UniProt UniProt  
  2.1.1.2.5.1 ERR3, isoform 1   UniProt T04644  
  2.1.1.2.5.2 ERR3, isoform 2   UniProt T04647  
  2.1.2 Family: Thyroid hormone receptor-related factors (NR1)    
  2.1.2.1 Subfamily: Retinoic acid receptors (NR1B) TGACCTTTGACCT  
  2.1.2.1.1 RAR-α (NR1B1) UniProt T01327 UniProt UniProt PDB
  2.1.2.1.1.1 RAR-α1   UniProt T01335  
  2.1.2.1.1.2 RAR-α2   UniProt T01336  
  2.1.2.1.2 RAR-β (NR1B2) UniProt T01328 UniProt UniProt  
  2.1.2.1.2.1 RAR-β1   UniProt T01337  
  2.1.2.1.2.2 RAR-β2   UniProt T01338  
  2.1.2.1.2.3 RAR-β3   UniProt T01339  
  2.1.2.1.2.4 RAR-β4   UniProt T01361  
  2.1.2.1.3 RAR-γ (NR1B3) UniProt T01329 UniProt UniProt  
  2.1.2.1.3.1 RAR-γ, isoform 1 (A)   UniProt T01340  
  2.1.2.1.3.2 RAR-γ, isoform 2 (B)   UniProt T26259  
  2.1.2.1.3.3 RAR-γ, isoform 3   UniProt T26260  
  2.1.2.2 Subfamily: Thyroid hormone receptors (NR1A) TGACCTGAAATGACCT  
  2.1.2.2.1 T3R-α (THRA) (NR1A1) UniProt T08894 UniProt UniProt  
  2.1.2.2.1.1 T3R-α1   UniProt T00836  
  2.1.2.2.1.2 T3R-α2   UniProt T01173  
  2.1.2.2.1.3 T3R-α3   UniProt T17546  
  2.1.2.2.1.4 T3R-αΔE6   UniProt T26340  
  2.1.2.2.2 T3R-β (NR1A2) UniProt T08896 UniProt UniProt PDB
  2.1.2.2.2.1 T3R-β1   UniProt T04722  
  2.1.2.2.2.2 T3R-β2   UniProt T04723  
  2.1.2.3 Subfamily: Rev-ErbA (NR1D) TGACCTAGTGACCT  
  2.1.2.3.1 Rev-ErbAα (NR1D1)   UniProt T06117 UniProt UniProt  
  2.1.2.3.2 Rev-ErbAβ (NR1D2)   UniProt T04896 UniProt UniProt  
  2.1.2.4 Subfamily: Vitamin D receptor (NR1I) TGACCTTCGTGACCT  
  2.1.2.4.1 VDR (NR1I1) UniProt T00883 UniProt UniProt PDB
  2.1.2.4.2 PXR (NR1I2)   UniProt T08235 UniProt UniProt  
  2.1.2.4.2.1 PXR, isoform 1 (PXR.1)   UniProt T04618  
  2.1.2.4.2.2 PXR, isoform 2 (PXR.2)   UniProt T04619  
  2.1.2.4.3 CAR (NR1I3)   UniProt T05687 UniProt UniProt  
  2.1.2.4.3.1 CAR1   UniProt T08261  
  2.1.2.4.3.2 CAR2   UniProt T02755  
  2.1.2.5 Subfamily: PPAR (NR1C) TGACCTTTGACCT  
  2.1.2.5.1 PPARα (NR1C1)   UniProt T00694 UniProt UniProt  
  2.1.2.5.2 PPARβ (PPARδ) (NR1C2)   UniProt T04781 UniProt UniProt PDB
  2.1.2.5.3 PPARγ (NR1C3)   UniProt T05347 UniProt UniProt PDB
  2.1.2.5.3.1 PPARγ1, isoform 1   UniProt T02529  
  2.1.2.5.3.2 PPARγ2, isoform 2   UniProt T05332  
  2.1.2.6 Subfamily: ROR (NR1F) TGACCTACTTAT  
  2.1.2.6.1 RORα (NR1F1) UniProt T06119 UniProt UniProtF  
  2.1.2.6.1.1 RORα1   UniProt T09284  
  2.1.2.6.1.2 RORα2   UniProt    
  2.1.2.6.1.3 RORα3   UniProt    
  2.1.2.6.1.4 RORα4   UniProt T15650  
  2.1.2.6.2 RORβ (NR1F2)   UniProt T17581 UniProt UniProt  
  2.1.2.6.2.1 RORβ, isoform 1   UniProt T19213  
  2.1.2.6.2.2 RORβ, isoform 2   UniProt T17683  
  2.1.2.6.3 RORγ (NR1F3)   UniProt T10351 UniProt UniProt  
  2.1.2.6.3.1 RORγ, isoform 1   UniProt T06118  
  2.1.2.6.3.2 RORγ, isoform 2 (RORgT)   UniProt T10350  
  2.1.2.7 Subfamily: LXR (NR1H) TGACCTCTACTGACCT  
  2.1.2.7.1 LXRα (NR1H3)   UniProt T04430 UniProt UniProt  
  2.1.2.7.2 LXRβ (NR1H2)   UniProt T04467 UniProt UniProt  
  2.1.2.7.3 FXR (NR1H4)   UniProt T02753 UniProt UniProt  
  2.1.2.7.3.1 FXR, isoform 1   UniProt T09890  
  2.1.2.7.3.2 FXR, isoform 2   UniProt T09299  
  2.1.3 Family: RXR-related receptors (NR2) (TGACCT)  
  2.1.3.1 Subfamily: Retinoid X receptors (NR2B) (TGACCT)  
  2.1.3.1.1 RXRα (NR2B1) UniProt T01331 UniProt UniProt PDB
  2.1.3.1.2 RXRβ (NR2B2) UniProt T01332 UniProt UniProtF  
  2.1.3.1.2.1 RXRβ1, isoform long   UniProt T02779  
  2.1.3.1.2.2 RXRβ2, isoform short   UniProt T01366  
  2.1.3.1.3 RXRγ (NR2B3) UniProt T01333 UniProt UniProt  
  2.1.3.2 Subfamily: HNF-4 (NR2A) AGTCCAAAGTTCA  
  2.1.3.2.1 HNF-4α (NR2A1) UniProt T01181 UniProt UniProt PDB
  2.1.3.2.1.1 HNF-4α, isoform long   UniProt T28928  
  2.1.3.2.1.2 HNF-4α, isoform short   UniProt T26145  
  2.1.3.2.2 HNF-4γ (NR2A2)   UniProt T06235 UniProt UniProt  
  2.1.3.3 Subfamily: Tailless-like receptors (NR2E) TGACCTTTGACCT  
  2.1.3.3.1 Tlx (NR2E1) UniProt T02357 UniProt UniProt  
  2.1.3.3.2 PNR (NR2E3)   UniProt T04861 UniProt    
  2.1.3.4 Subfamily: Testicular receptors (NR2C) TGACCTCTGACCT  
  2.1.3.4.1 TR2 (NR2C1)   UniProt T04847 UniProt UniProt  
  2.1.3.4.1.1 TR2-11, isoform 1   UniProt T11074  
  2.1.3.4.1.2 TR2-9, isoform 2 (TR2-11-t)   UniProt T11075  
  2.1.3.4.2 TR4 (NR2C2) UniProt T16549 UniProt UniProt  
  2.1.3.5 Subfamily: COUP-like receptors (NR2F) TGACCTTTGACCT  
  2.1.3.5.1 COUP-TFI (NR2F1) UniProt T00994 UniProt UniProt PDB
  2.1.3.5.2 COUP-TFII (NR2F2)   UniProt T06154 UniProt UniProt  
  2.1.3.5.3 EAR2 (NR2F6) UniProt T06163 UniProt UniProt  
  2.1.4 Family: NGFI-B-related receptors (NR4) TGACCTTT  
  2.1.4.0.1 NGFI-B (Nur77, NR4A1)   UniProt T01348 UniProt UniProt PDB
  2.1.4.0.2 NURR1 (NR4A2) UniProt T10226 UniProt UniProt  
  2.1.4.0.2.1 NURR1, isoform 1   UniProt T04312  
  2.1.4.0.2.2 NURR1, isoform 2 (NURR1A)   UniProt T10247  
  2.1.4.0.3 NOR1 (NR4A3, TEC)   UniProt T15963 UniProt UniProt  
  2.1.4.0.3.1 NOR1, isoform α (long)   UniProt T19145  
  2.1.4.0.3.2 NOR1, isoform β (short, TECΔC)   UniProt T19146  
  2.1.5 Family: FTZ-F1-related receptors (NR5) TGACCTTG  
  2.1.5.0.1 FTZ-F1 (SF-1) (NR5A1)   UniProt T08551 UniProt UniProt PDB
  2.1.5.0.1.1 FTZ-F1, isoform 1   UniProt T09519  
  2.1.5.0.1.2 FTZ-F1, isoform 2   UniProt T25132  
  2.1.5.0.2 LRH-1 (NR5A2)   UniProt T04754 UniProt UniProt  
  2.1.6 Family: GCNF-related receptors (NR6) TGAACTTGACTTGA  
  2.1.6.0.1 GCNF (NR6A1)   UniProt T15701 UniProt UniProtF  
  2.1.6.0.1.1 GCNF, isoform 1   UniProt T02772  
  2.1.6.0.1.2 GCNF, isoform 2   UniProt T26225  
  2.1.6.0.1.3 GCNF, isoform 3   UniProt T26226  
  2.1.7 Family: DAX-related receptors (NR0) TGACCTT  
  2.1.7.0.1 DAX1 (NR0B1)   UniProt T04677 UniProt UniProt  
  2.1.7.0.2 SHP (NR0B2)   UniProt T05321 UniProt UniProt  
  2.2 Class: Other C4 zinc finger-type factors TRANSFAC class description Further information
  2.2.1 Family: GATA-type zinc fingers    
  2.2.1.1 Subfamily: Two zinc-finger GATA factors AGATAA  
  2.2.1.1.1 GATA-1 (GF-1, EryF1, NF-E1)   UniProt T00305 UniProt UniProt PDB
  2.2.1.1.1.1 GATA-1, isoform 1   UniProt T08291  
  2.2.1.1.1.2 GATA-1, isoform 2 (GATA-1s)   UniProt T26130  
  2.2.1.1.2 GATA-2   UniProt T01302 UniProt UniProt  
  2.2.1.1.3 GATA-3 UniProt T00310 UniProt UniProt  
  2.2.1.1.4 GATA-4 UniProt T02532 UniProt UniProt  
  2.2.1.1.5 GATA-5 UniProt T02685 UniProt UniProt  
  2.2.1.1.6 GATA-6   UniProt T02686 UniProt UniProt  
  2.2.1.1.6.1 GATA-6, isoform 1   UniProt T10208  
  2.2.1.1.6.2 GATA-6, isoform 2   UniProt T26132  
  2.2.1.2 Subfamily: Single GATA-type zinc-finger AGATAA  
  2.2.1.2.1 GATAD1 (ODAG)   UniProt T UniProt UniProt  
  2.2.1.2.1.1 GATAD1, isoform 1   UniProt T  
  2.2.1.2.1.2 GATAD1, isoform 2   UniProt T  
  2.2.1.2.2 p66-α (GATAD2A)   UniProt T UniProt UniProt  
  2.2.1.2.3 p66-β (GATAD2B)   UniProt T UniProt UniProt  
  2.2.1.2.3.1 p66-β, isoform 1   UniProt T  
  2.2.1.2.3.2 p66-β, isoform 2   UniProt T  
  2.2.1.2.4 RERE (ARG, ARP, ATN1L) = 3.5.1.3.7   UniProt T UniProt UniProt  
  2.2.1.2.5 MTA1 = 3.5.1.3.4   UniProt T27821 UniProt UniProt  
  2.2.1.2.6 MTA2 (MTA1L1, PID) = 3.5.1.3.5   UniProt T UniProt UniProt  
  2.2.1.2.7 MTA3 = 3.5.1.3.6   UniProt T27832 UniProt UniProtF  
  2.2.1.2.7.1 MTA3, isoform 1   UniProt T27227  
  2.2.1.2.7.2 MTA3, isoform 2   UniProt T27228  
  2.2.1.2.8 ZGLP1 (GLP-1)   UniProt T UniProt UniProt  
  2.2.1.2.9 DNMT3A   UniProt T27827 UniProt UniProt  
  2.2.1.2.9.1 DNMT3A, isoform 1   UniProt T27196  
  2.2.1.2.9.2 DNMT3A, isoform 2   UniProt T27868  
  2.2.1.2.10 DNMT3B   UniProt T UniProt UniProt  
  2.2.1.2.10.1 DNMT3B, isoform 1   UniProt T  
  2.2.1.2.10.2 DNMT3B, isoform 2   UniProt T  
  2.2.1.2.10.3 DNMT3B, isoform 3   UniProt T  
  2.2.1.2.10.4 DNMT3B, isoform 4   UniProt T  
  2.2.1.2.11 DNMT3L   UniProt T UniProt UniProt  
  2.2.1.2.12 ATRX (RAD54L, XH2)   UniProt T UniProt UniProt PDB
  2.2.1.2.13 TRPS1 (GC79) = 2.3.4.0.20   UniProt T19349 UniProt UniProt  
  2.3 Class: C2H2 zinc finger factors TRANSFAC class description Further information
  2.3.1 Family: Three-zinc finger Krüppel-related factors    
  2.3.1.1 Subfamily: Sp1-like factors GGGGCGGGG  
  2.3.1.1.1 Sp1 UniProt T00752 UniProt UniProt PDB
  2.3.1.1.1.1 Sp1, isoform 1   UniProt T09118  
  2.3.1.1.1.2 Sp1, isoform 2 (Sp1-S)   UniProt T11472  
  2.3.1.1.2 Sp2   UniProt T06543 UniProt UniProt  
  2.3.1.1.2.1 Sp2, isoform 1   UniProt T10134  
  2.3.1.1.2.2 Sp2, isoform 2   UniProt T10135  
  2.3.1.1.3 Sp3 UniProt T05840 UniProt UniProtF  
  2.3.1.1.3.1 Sp3, isoform 1 (L-Sp3)   UniProt T19262  
  2.3.1.1.3.2 Sp3, isoform 2   UniProt T19261  
  2.3.1.1.3.3 Sp3, isoform 3 (M1-Sp3)   UniProt T26303  
  2.3.1.1.4 Sp4 UniProt T02414 UniProt UniProt  
  2.3.1.1.5 Sp5   UniProt T19265 UniProt UniProt  
  2.3.1.1.6 Sp6   UniProt T05074 UniProt UniProt  
  2.3.1.1.7 Sp7   UniProt T20132 UniProt UniProt  
  2.3.1.1.8 Sp8 UniProt T27853 UniProt UniProt  
  2.3.1.1.9 Sp9   UniProt T UniProt UniProt  
  2.3.1.1.9.1 Sp9, isoform 1   UniProt T  
  2.3.1.1.9.2 Sp9, isoform 2   UniProt T  
  2.3.1.2 Subfamily: Krüppel-like factors CCACACCCT  
  2.3.1.2.1 KLF1 (EKLF)   UniProt T01676 UniProt UniProt  
  2.3.1.2.2 KLF2 (LKLF)   UniProt T01677 UniProt UniProt  
  2.3.1.2.3 KLF3 (BKLF)   UniProt T10980 UniProt UniProt PDB
  2.3.1.2.4 KLF4 (GKLF)   UniProt T02450 UniProt UniProt PDB
  2.3.1.2.5 KLF5 (CKLF, IKLF, BTEB2)   UniProt T05054 UniProt UniProt PDB
  2.3.1.2.6 KLF6 (CPBP, BCD1)   UniProt T19036 UniProt UniProt  
  2.3.1.2.7 KLF7 (UKLF)   UniProt T26756 UniProt UniProtF  
  2.3.1.2.8 KLF8 (BKLF)   UniProt T20006 UniProt UniProt  
  2.3.1.2.9 KLF9 (BTEB1)   UniProt T04700 UniProt UniProt  
  2.3.1.2.10 KLF10 (TIEG1)   UniProt T15844 UniProt UniProt PDB
  2.3.1.2.11 KLF11 (FKLF, TIEG2)   UniProt T17849 UniProt UniProt  
  2.3.1.2.12 KLF12 (AP-2rep) UniProt T04701 UniProt UniProt  
  2.3.1.2.13 KLF13 (BTEB3, NSLP1) UniProt T05052 UniProt UniProt  
  2.3.1.2.14 KLF14 (BTEB5) UniProt T20000 UniProt UniProt  
  2.3.1.2.15 KLF15 (KKLF)   UniProt T20002 UniProt UniProt PDB
  2.3.1.2.16 KLF16 (BTEB4, NSLP2) UniProt T05053 UniProt UniProt  
  2.3.1.2.17 KLF17   UniProt T20004 UniProt UniProt  
  2.3.1.3 Subfamily: EGR factors GCGTGGGCG  
  2.3.1.3.1 EGR1 (Krox-24, Zif268) UniProt T10013 UniProt UniProt PDB
  2.3.1.3.2 EGR2 (Krox-20) UniProt T00454 UniProt UniProt  
  2.3.1.3.2.1 EGR2, isoform long   UniProt T25981  
  2.3.1.3.2.2 EGR2, isoform short   UniProt T08340  
  2.3.1.3.3 EGR3 (PILOT) UniProt T05539 UniProt UniProt  
  2.3.1.3.4 EGR4 UniProt T19919 UniProt UniProt  
  2.3.2 Family: Other factors with up to three adjacent zinc fingers    
  2.3.2.1 Subfamily: Factors with 2-3 adjacent zinc fingers
and a BTB/POZ domain
TCCTGCTA  
  2.3.2.1.1 ZBTB5 [2]   UniProt T19397 UniProt UniProt  
  2.3.2.1.2 ZBTB8B [2]   UniProt T UniProt UniProt  
  2.3.2.1.6 ZBTB22 (ZNF297, BING1) [3]   UniProt T19377 UniProt UniProt  
  2.3.2.1.7 ZBTB32 (ZNF538, FAZF) [3]   UniProt T15957 UniProt UniProt  
  2.3.2.1.7.1 ZBTB32, isoform 1   UniProt T15956  
  2.3.2.1.7.2 ZBTB32, isoform 2   UniProt T15958  
  2.3.2.1.8 ZBTB34 [3]   UniProt T UniProt UniProt  
  2.3.2.1.9 ZBTB37 [3]   UniProt T UniProt UniProt  
  2.3.2.1.10 ZBTB43 (ZBTB22B, ZNF297B) [3]   UniProt T19385 UniProt UniProt PDB
  2.3.2.1.11 ZBTB46 (BTBD4, ZNF340) [2]   UniProt T UniProt UniProt  
  2.3.2.1.11.1 ZBTB46, isoform 1   UniProt T  
  2.3.2.1.11.2 ZBTB46, isoform 2   UniProt T  
  2.3.2.1.12 ZBTB33 (KAISO, ZNF348) [3]   UniProt T08299 UniProt UniProt  
  2.3.2.2 Subfamily: Factors with 2-3 adjacent zinc fingers
and a KRAB domain
   
  2.3.2.3 Subfamily: Factors with 2-3 adjacent zinc fingers
and a SCAN domain
   
  2.3.2.4 Subfamily: Other three adjacent zinc finger factors    
  2.3.2.4.1 ZNF414 (Zfp414) [3]   UniProt T20584 UniProt UniProt  
  2.3.2.4.1.1 ZNF414, isoform 1   UniProt T20583  
  2.3.2.4.1.2 ZNF414, isoform 2   UniProt T20585  
  2.3.2.4.2 ZNF511 (Zfp511) [3]   UniProt T UniProt UniProt  
  2.3.2.4.2.1 ZNF511, isoform 1   UniProt T  
  2.3.2.4.2.2 ZNF511, isoform 2   UniProt T  
  2.3.2.4.3 ZNF580 (Zfp580) [3]   UniProt T19527 UniProt UniProt  
  2.3.2.4.5 ZNF740 (ZFP740) [3] UniProt T16895 UniProt UniProt  
  2.3.2.4.5.1 ZNF740, isoform 1   UniProt T16894  
  2.3.2.4.5.2 ZNF740, isoform 2   UniProt T16897  
  2.3.2.4.5.3 ZNF740, isoform 3   UniProt T16898  
  2.3.2.4.6 ZFPM2 (ZNF89B, FOG2) = 2.7.2.0.2 [3]   UniProt T18922 UniProt UniProtF  
  2.3.2.4.6.1 ZFPM2, isoform 1   UniProt T18923  
  2.3.2.4.6.2 ZFPM2, isoform 2   UniProt T18924  
  2.3.2.4.6.3 ZFPM2, isoform 3   UniProt T18925  
  2.3.2.4.7 OSR1 (ODD) [3]   UniProt T16932 UniProt UniProt  
  2.3.2.4.8 OVOL3 (OVL2L) [4]   UniProt T UniProt UniProtF, ?  
  2.3.2.4.9 AEBP2 [2]   UniProt T18741 UniProt UniProt  
  2.3.2.4.9.1 AEBP2, isoform 1   UniProt T18740  
  2.3.2.4.9.2 AEBP2, isoform 2   UniProt T18736  
  2.3.2.4.9.3 AEBP2, isoform 3   UniProt T18737  
  2.3.2.4.9.4 AEBP2, isoform 4   UniProt T18738  
  2.3.2.4.9.5 AEBP2, isoform 5   UniProt T18739  
  2.3.3 Family: More than 3 adjacent zinc finger factors    
  2.3.3.1 Subfamily: GLI-like factors TGGGTGGTC  
  2.3.3.1.1 GLI1 [5]   UniProt T06385 UniProt UniProt PDB
  2.3.3.1.2 GLI2 [5] UniProt T06386 UniProt UniProt  
  2.3.3.1.3 GLI3 [5]   UniProt T06387 UniProt UniProt  
  2.3.3.1.4 GLIS1 [5] UniProt T06390 UniProt UniProt  
  2.3.3.1.4.1 GLIS1, isoform 1   UniProt T11184  
  2.3.3.1.4.2 GLIS1, isoform 2   UniProt T26134  
  2.3.3.1.5 GLIS2 (NKL) [5] UniProt T UniProt UniProt  
  2.3.3.1.6 GLIS3 (ZNF515) [5] UniProt T17410 UniProt UniProt  
  2.3.3.1.6.1 GLIS3, isoform 1   UniProt T18954  
  2.3.3.1.6.2 GLIS3, isoform 2   UniProt T15909  
  2.3.3.1.7 ZIC1 (ZNF201) [5] UniProt T04669 UniProt UniProt  
  2.3.3.1.8 ZIC2 [5]   UniProt T04670 UniProt UniProt  
  2.3.3.1.9 ZIC3 (ZNF203) [5] UniProt T04671 UniProt UniProt PDB
  2.3.3.1.9.1 ZIC3, isoform 1 (ZIC3A)   UniProt T14517  
  2.3.3.1.9.2 ZIC3, isoform 2 (ZIC3B)   UniProt T26531  
  2.3.3.1.10 ZIC4 [5] UniProt T UniProt UniProtF  
  2.3.3.1.11 ZIC5 [4]   UniProt T UniProt UniProt  
  2.3.3.2 Subfamily: Snail-like factors CACCTG  
  2.3.3.2.1 SNAI1 [4]   UniProt T02333 UniProt UniProt  
  2.3.3.2.2 SNAI2 (SLUG) [5] UniProt T19238 UniProt UniProt  
  2.3.3.2.3 SNAI3 (ZNF293) [5]   UniProt T10589 UniProt UniProt  
  2.3.3.2.4 SCRT1 [5] UniProt T20104 UniProt UniProt  
  2.3.3.2.5 SCRT2 [5] UniProt T20108 UniProt UniProt  
  2.3.3.3 Subfamily: ZFP91-like factors    
  2.3.3.3.1 ZFP91 (ZNF757) [5]   UniProt T19408 UniProt UniProt  
  2.3.3.3.1.1 ZFP91, isoform 1   UniProt T19407  
  2.3.3.3.1.2 ZFP91, isoform 2   UniProt T26362  
  2.3.3.3.2 ZNF692 [5]   UniProt T19554 UniProt UniProt PDB
  2.3.3.3.3 ZNF276 (ZFP276, ZNF477) [5]   UniProt T20488 UniProt UniProt  
  2.3.3.3.3.1 ZNF276, isoform 1   UniProt T20487  
  2.3.3.3.3.2 ZNF276, isoform 2   UniProt T20489  
  2.3.3.3.4 ZNF653 (ZIP67) [5]   UniProt T20934 UniProt UniProt  
  2.3.3.3.4.1 ZNF653, isoform 1   UniProt T20933  
  2.3.3.3.4.2 ZNF653, isoform 2   UniProt T20935  
  2.3.3.4 Subfamily: ZNF280-like zinc finger factors    
  2.3.3.4.2 ZNF280B (SUHW2, ZNF279, ZNF632, Zfp280b) [4]   UniProt T UniProt UniProt  
  2.3.3.4.3 ZNF280C (SUHW3, ZNF633, Zfp280c) [5]   UniProt T20167 UniProt UniProt  
  2.3.3.4.4 ZNF280D (SUHW4, ZNF634) [5]   UniProt T20177 UniProt UniProt  
  2.3.3.4.4.1 ZNF280D, isoform 1   UniProt T20176  
  2.3.3.4.4.2 ZNF280D, isoform 2   UniProt T20178  
  2.3.3.4.4.3 ZNF280D, isoform 3   UniProt T20179  
  2.3.3.4.5 POGZ (SUHW5, ZNF280E, ZNF635) [9]   UniProt T UniProt UniProt PDB
  2.3.3.5 Subfamily: ZSCAN5-like zinc finger factors    
  2.3.3.6 Subfamily: ZNF75-like zinc finger factors    
  2.3.3.7 Subfamily: ZNF705 factors    
  2.3.3.8 Subfamily: ZBTB7 factors GACCCC  
  2.3.3.8.1 ZBTB7A [4] UniProt T08304 UniProt UniProt  
  2.3.3.8.1.1 ZBTB7A, isoform 1   UniProt T19395  
  2.3.3.8.1.2 ZBTB7A, isoform 2   UniProt T08303  
  2.3.3.8.2 ZBTB7B [4] UniProt T09541 UniProt UniProt  
  2.3.3.8.3 ZBTB7C [4] UniProt T UniProt UniProt  
  2.3.3.9 Subfamily: YY1-like factors GCCATCTTG  
  2.3.3.9.1 YY1 [4] UniProt T00278 UniProt UniProt PDB
  2.3.3.9.2 YY2 (ZNF631) [4] UniProt T17589 UniProt UniProt  
  2.3.3.9.3 ZFP42 (REX1, ZNF754) [4]   UniProt T00727 UniProt  
  2.3.3.10 Subfamily: ZNF24-like factors TCAT  
  2.3.3.10.1 ZNF24 (KOX17, ZNF191, ZSCAN3) [4]   UniProt T21161 UniProt UniProt PDB
  2.3.3.10.6 ZKSCAN1 (KOX18, ZNF139, ZNF36) [6]   UniProt T20343 UniProt UniProt  
  2.3.3.10.6.1 ZKSCAN1, isoform 1   UniProt T20342  
  2.3.3.10.6.2 ZKSCAN1, isoform 2   UniProt T20344  
  2.3.3.11 Subfamily: ZBTB6-like factors    
  2.3.3.11.1 ZBTB6 (ZID, ZNF482) [4]   UniProt T19399 UniProt UniProt  
  2.3.3.11.2 ZBTB26 (ZNF481) [4]   UniProt T UniProt UniProt  
  2.3.3.11.3 ZBTB12 (NG35) [4]   UniProt T16838 UniProt UniProt  
  2.3.3.12 Subfamily: PRDM1-like factors AAGTGAAAGT  
  2.3.3.12.1 PRDM1 (BLIMP1) [4] UniProt T02316 UniProt UniProt  
  2.3.3.12.1.1 PRDM1, isoform 1   UniProt T14505  
  2.3.3.12.1.2 PRDM1, isoform 2 (1A)   UniProt T26255  
  2.3.3.12.1.3 PRDM1, isoform 3 (1B)   UniProt T26256  
  2.3.3.12.1.4 PRDM1, isoform 4 (1C)   UniProt T26257  
  2.3.3.12.1.5 PRDM1, isoform 5 (delta exon 7)   UniProt T26258  
  2.3.3.13 Subfamily: ZNF148-like factors CACCC  
  2.3.3.13.1 ZNF148 (ZBP89, Zfp148) [4]   UniProt T08694 UniProt UniProt  
  2.3.3.13.2 ZNF281 (GZP1, ZBP99, Zfp281) [4]   UniProt T16856 UniProt  
  2.3.3.14 Subfamily: ZBTB20-like factors    
  2.3.3.14.1 ZBTB20 (DPZF, ZNF288, HOF) [5]   UniProt T15597 UniProt UniProt  
  2.3.3.14.1.1 ZBTB20, isoform 1 (HOF-L)   UniProt T15595  
  2.3.3.14.1.2 ZBTB20, isoform 2 (HOF-S)   UniProt T15596  
  2.3.3.14.2 ZBTB45 (ZNF499) [4]   UniProt T UniProt UniProt  
  2.3.3.15 Subfamily: ZNF524-like factors    
  2.3.3.15.1 ZNF524 (Zfp524) [4] UniProt T20724 UniProt  
  2.3.3.16 Subfamily: ZNF238-like factors AACATCTGGA  
  2.3.3.16.1 ZNF238 (RP58, TAZ1, ZBTB18) [4] UniProt T16607 UniProt UniProt  
  2.3.3.16.2 ZBTB42 [4]   UniProt T UniProt UniProt  
  2.3.3.16.2.1 ZBTB42, isoform 1   UniProt T  
  2.3.3.16.2.2 ZBTB42, isoform 2   UniProt T  
  2.3.3.17 Subfamily: OVOL-factors GCGGGGG  
  2.3.3.17.1 OVOL1 [4]   UniProt T08547 UniProt UniProt  
  2.3.3.17.2 OVOL2 (mOVO, ZNF339) [4]   UniProt T08543 UniProt UniProt  
  2.3.3.17.2.1 OVOL2, isoform 1 (MOVO-A)   UniProt T08542  
  2.3.3.17.2.2 OVOL2, isoform 2 (MOVO-C)   UniProt T08545  
  2.3.3.17.2.3 OVOL2, isoform 3 (MOVO-B)   UniProt T08544  
  2.3.3.18 Subfamily: ZNF56-like factors    
  2.3.3.19 Subfamily: ZNF500-like factors    
  2.3.3.19.3 ZKSCAN2 (ZNF694) [6]   UniProt T UniProt UniProt  
  2.3.3.19.4 ZSCAN29 (ZNF690) [6]   UniProt T UniProt  
  2.3.3.20 Subfamily: FEZF factors    
  2.3.3.20.1 FEZF1 (ZNF312B) [6]   UniProt T19931 UniProt UniProt  
  2.3.3.20.2 FEZF2 (FEZL, ZNF312) [6]   UniProt T19936 UniProt UniProt  
  2.3.3.21 Subfamily: GFI1 factors AAATCACAGC  
  2.3.3.21.1 GFI1 (ZNF163) [6]   UniProt T06593 UniProt UniProt PDB
  2.3.3.21.2 GFI1B [6]   UniProt T06585 UniProt UniProt  
  2.3.3.22 Subfamily: BCL6 factors CTTTCTAGGAAT  
  2.3.3.22.1 BCL6B (BAZF, ZNF62) [5] UniProt T16794 UniProt UniProt  
  2.3.3.22.2 BCL6 (LAZ3, ZBTB27, ZNF51) [6]   UniProt T08156 UniProt UniProt  
  2.3.3.23 Subfamily: ZNF212-like factors    
  2.3.3.24 Subfamily: MTF1-like factors TGCACAC  
  2.3.3.24.1 MTF1 [6] UniProt T00515 UniProt UniProt  
  2.3.3.24.2 ZNF410 (APA1, Zfp410) [5] UniProt T16880 UniProt  
  2.3.3.24.2.1 ZNF410, isoform 1   UniProt T16879  
  2.3.3.24.2.2 ZNF410, isoform 2   UniProt T16883  
  2.3.3.24.2.3 ZNF410, isoform 3   UniProt T16884  
  2.3.3.25 Subfamily: PLAG factors    
  2.3.3.25.1 PLAGL2 [6]   UniProt T18384 UniProt UniProt  
  2.3.3.25.2 PLAG1 [7]   UniProt T21518 UniProt UniProt  
  2.3.3.25.3 PLAGL1 (LOT1, ZAC) [7]   UniProt T10142 UniProt UniProt  
  2.3.3.26 Subfamily: ZKSCAN3-like factors TGAGGGG  
  2.3.3.26.1 ZKSCAN3 (ZFP47, ZNF306, ZNF309, ZSCAN13) [7] UniProt T UniProt UniProt  
  2.3.3.26.2 ZKSCAN4 (ZNF307, ZNF427) [7]   UniProt T UniProt UniProtF  
  2.3.3.27 Subfamily: ZNF525-like factors    
  2.3.3.28 Subfamily: ZNF76-like factors CCCATCATGCCTTGC  
  2.3.3.28.1 ZNF76 (ZNF523, Zfp523) [7]   UniProt T19573 UniProt UniProt  
  2.3.3.28.1.1 ZNF76, isoform 1   UniProt T25999  
  2.3.3.28.1.2 ZNF76, isoform 2   UniProt T26000  
  2.3.3.28.2 ZNF143 (SBF, STAF) [7] UniProt T18502 UniProt UniProt  
  2.3.3.28.2.1 ZNF143, isoform 1   UniProt T18501  
  2.3.3.28.2.2 ZNF143, isoform 2   UniProt T26365  
  2.3.3.28.2.3 ZNF143, isoform 3   UniProt T26366  
  2.3.3.29 Subfamily: ZNF652-like factors    
  2.3.3.29.1 ZNF652 (ZFP652) [9] UniProt T20929 UniProt UniProt  
  2.3.3.29.1.1 ZNF652, isoform 1   UniProt T20928  
  2.3.3.29.1.2 ZNF652, isoform 2   UniProt T20930  
  2.3.3.30 Subfamily: ZNF350-like factors TGGgttCAGactTTG  
  2.3.3.31 Subfamily: ZNF642-like factors    
  2.3.3.31.4 ZNF583 [12]   UniProt T20839 UniProt  
  2.3.3.32 Subfamily: ZNF679-like factors    
  2.3.3.33 Subfamily: ZNF763-like factors    
  2.3.3.34 Subfamily: ZNF3-like factors    
  2.3.3.35 Subfamily: ZNF620-like factors    
  2.3.3.36 Subfamily: ZNF324 factors    
  2.3.3.37 Subfamily: ZNF362-like factors    
  2.3.3.38 Subfamily: ZNF282-like factors TCCACCCC  
  2.3.3.39 Subfamily: ZNF764-like factors    
  2.3.3.39.3 ZNF771 [8]   UniProt T21051 UniProt  
  2.3.3.40 Subfamily: ZNF177-like factors    
  2.3.3.41 Subfamily: ZNF32-like factors    
  2.3.3.41.1 ZNF32 (KOX30, Zfp637) [7]   UniProt T UniProt UniProt PDB
  2.3.3.41.1.1 ZNF32, isoform 1   UniProt T  
  2.3.3.41.1.2 ZNF32, isoform 2   UniProt T  
  2.3.3.41.2 ZIK1 (ZNF762) [9]   UniProt T20335 UniProt  
  2.3.3.42 Subfamily: ZNF773-like factors    
  2.3.3.43 Subfamily: ZNF558-like factors    
  2.3.3.44 Subfamily: ZNF302-like factors    
  2.3.3.44.2 ZNF2 (ZNF661, Zfp661) [9]   UniProt T21173 UniProt  
  2.3.3.45 Subfamily: ZNF562-like factors    
  2.3.3.46 Subfamily: ZXD-factors    
  2.3.3.46.2 ZXDB [10]   UniProt T UniProt  
  2.3.3.46.3 ZXDC (ZXDL) [10]   UniProt T UniProt UniProt  
  2.3.3.46.3.1 ZXDC, isoform 1   UniProt T  
  2.3.3.46.3.2 ZXDC, isoform 2   UniProt T  
  2.3.3.46.3.3 ZXDC, isoform 3   UniProt T  
  2.3.3.46.3.4 ZXDC, isoform 4   UniProt T  
  2.3.3.47 Subfamily: ZNF222-like factors    
  2.3.3.48 Subfamily: ZNF736-like factors    
  2.3.3.49 Subfamily: ZNF286 factors    
  2.3.3.50 Subfamily: CTCF-like factors    
  2.3.3.50.1 CTCF [11] UniProt T02285 UniProt UniProt  
  2.3.3.50.2 CTCFL (CTCF-T, BORIS) [11]   UniProt T UniProt UniProt  
  2.3.3.50.2.1 CTCFL, isoform 1   UniProt T  
  2.3.3.50.2.2 CTCFL, isoform 2   UniProt T  
  2.3.3.51 Subfamily: ZNF366-like factors    
  2.3.3.51.2 ZNF710 (Zfp710) [11]   UniProt T21014 UniProt  
  2.3.3.51.2.1 ZNF710, isoform 1   UniProt T21013  
  2.3.3.51.2.2 ZNF710, isoform 2   UniProt T21015  
  2.3.3.51.2.3 ZNF710, isoform 3   UniProt T21016  
  2.3.3.52 Subfamily: ZNF322-like factors    
  2.3.3.52.1 ZNF322A (ZNF322, ZNF388, ZNF489, Zfp322A) [11]   UniProt T20185 UniProt UniProt  
  2.3.3.53 Subfamily: ZNF548-like factors    
  2.3.3.54 Subfamily: ZNF460-like factors    
  2.3.3.55 Subfamily: ZNF146-like factors    
  2.3.3.55.1 ZNF146 [10]   UniProt T UniProt  
  2.3.3.55.2 ZNF260 (ZFP260) [13]   UniProt T20476 UniProt UniProt  
  2.3.3.56 Subfamily: ZNF214-like factors    
  2.3.3.57 Subfamily: ZNF479-like factors    
  2.3.3.58 Subfamily: ZNF180-like factors    
  2.3.3.58.3 ZNF436 (Zfp46) [12]   UniProt T20615 UniProt UniProt  
  2.3.3.58.6 ZSCAN2 (ZFP29, ZNF854) [14]   UniProt T21249 UniProt UniProt  
  2.3.3.59 Subfamily: ZNF100-like factors    
  2.3.3.59.3 ZNF431 (Zfp431, Zfp923) [13]   UniProt T23370 UniProt  
  2.3.3.60 Subfamily: ZNF98-like factors    
  2.3.3.61 Subfamily: ZNF343-like factors    
  2.3.3.62 Subfamily: ZFP2-like factors    
  2.3.3.62.1 ZFP2 (ZNF751, Mkr2) [13]   UniProt T UniProt UniProt  
  2.3.3.62.1.1 ZFP2, isoform 1   UniProt    
  2.3.3.62.1.2 ZFP2, isoform 2   UniProt T02335  
  2.3.3.63 Subfamily: ZFP30-like factors    
  2.3.3.63.1 ZFP30 (ZNF745) [13]   UniProt T20292 UniProt  
  2.3.3.63.2 ZFP82 (ZNF545) [13]   UniProt T20313 UniProt UniProt  
  2.3.3.63.2.1 ZFP82, isoform 1   UniProt T20312  
  2.3.3.63.2.2 ZFP82, isoform 2   UniProt T20314  
  2.3.3.63.2.3 ZFP82, isoform 3   UniProt T28055  
  2.3.3.63.3 ZFP14 (ZNF531) [13]   UniProt T UniProt UniProt  
  2.3.3.64 Subfamily: ZNF354A-like factors    
  2.3.3.64.1 ZNF354A (EZNF, HKL1, TCF17, Zfp354a) [13]   UniProt T19363 UniProt UniProt  
  2.3.3.64.2 ZNF354B (Zfp354b) [13]   UniProt T20196 UniProt UniProt  
  2.3.3.65 Subfamily: ZFX/ZFY factors AGGCCC  
  2.3.3.65.1 ZFX [13]   UniProt T16099 UniProt UniProt  
  2.3.3.65.2 ZFY-1 [13]   UniProt T20325 UniProt PDB
  2.3.3.65.3 ZFY-2 [13]   UniProt T20327 UniProt PDB
  2.3.3.66 Subfamily: ZNF689-like factors    
  2.3.3.66.1 ZNF689 (Zfp689) [12]   UniProt T20996 UniProt UniProt  
  2.3.3.66.2 ZNF672 (Zfp672) [14]   UniProt T20968 UniProt UniProt  
  2.3.3.67 Subfamily: ZFN283-like factors    
  2.3.3.68 Subfamily: ZFN81-like factors    
  2.3.3.69 Subfamily: ZFN25-like factors    
  2.3.3.69.3 ZFP37 [12]   UniProt T21364 UniProt UniProt  
  2.3.3.70 Subfamily: ZFN26-like factors    
  2.3.3.71 Subfamily: ZFN300-like factors    
  2.3.3.72 Subfamily: ZFN813-like factors    
  2.3.3.73 Subfamily: ZNF816A-like factors    
  2.3.3.74 Subfamily: ZNF442-like factors    
  2.3.3.75 Subfamily: ZNF432-like factors    
  2.3.3.76 Subfamily: ZNF665-like factors    
  2.3.3.77 Subfamily: ZNF595-like factors    
  2.3.3.78 Subfamily: ZNF14-like factors    
  2.3.3.79 Subfamily: ZNF841-like factors    
  2.3.3.80 Subfamily: ZNF99-like factors    
  2.3.3.0 Subfamily: unclassified    
  2.3.3.0.1 ZFP161 (ZBTB14, ZNF478, Zfp5) CTACCTGCACAGTTCACGGA UniProt T02349 UniProt UniProt  
  2.3.3.0.3 ZNF496 (ZKSCAN17, Zfp496) UniProt T UniProt UniProt  
  2.3.3.0.3.1 ZNF496, isoform 1   UniProt T  
  2.3.3.0.3.2 ZNF496, isoform 2   UniProt T  
  2.3.3.0.3.3 ZNF496, isoform 3   UniProt T  
  2.3.3.0.9 OSR2   UniProt T16872 UniProt UniProt  
  2.3.3.0.9.1 OSR2, isoform 1 (OSR2A)   UniProt T16871  
  2.3.3.0.9.2 OSR2, isoform 2 (OSR2B)   UniProt T16873  
  2.3.3.0.13 ZNF22 (KOX15, KROX26, Zfp422) CAATG UniProt T21157 UniProt UniProt  
  2.3.3.0.17 ZFP41   UniProt T20302 UniProt UniProt  
  2.3.3.0.20 ZNF18 (KOX11, ZKSCAN6, ZNF535, Zfp18, Zfp535)   UniProt T21150 UniProt UniProt  
  2.3.3.0.21 WT1 CGCCCCCGC UniProt T02351 UniProt UniProt PDB
  2.3.3.0.21.1 WT1, isoform 1   UniProt T09249  
  2.3.3.0.21.2 WT1, isoform 2   UniProt T19358  
  2.3.3.0.21.3 WT1, isoform 3   UniProt T19356  
  2.3.3.0.21.4 WT1, isoform 4   UniProt T19357  
  2.3.3.0.21.5 WT1, isoform 5   UniProt T26353  
  2.3.3.0.21.6 WT1, isoform 6   UniProt T26354  
  2.3.3.0.23 PRDM6 (PFM3)   UniProt T27850 UniProt UniProt  
  2.3.3.0.23.1 PRDM6, isoform 1   UniProt T27355  
  2.3.3.0.23.2 PRDM6, isoform 2   UniProt T27928  
  2.3.3.0.23.3 PRDM6, isoform 3   UniProt T27929  
  2.3.3.0.23.4 PRDM6, isoform 4   UniProt T27930  
  2.3.3.0.24 ZNF444 (EZF2, ZSCAN17, Zfp44)   UniProt T UniProt UniProt  
  2.3.3.0.25 ZNF641 (Zfp641)   UniProt T20912 UniProt UniProt  
  2.3.3.0.25.1 ZNF641, isoform 1   UniProt T20911  
  2.3.3.0.25.2 ZNF641, isoform 2   UniProt T20913  
  2.3.3.0.26 ZNF746 (PARIS, Zfp746) TATTTTT UniProt T UniProt UniProt  
  2.3.3.0.28 ZBTB44 (BTBD15, ZNF851)   UniProt T19390 UniProt UniProt  
  2.3.3.0.28.1 ZBTB44, isoform 1   UniProt T19389  
  2.3.3.0.28.2 ZBTB44, isoform 2   UniProt T26360  
  2.3.3.0.31 ZNF655 (VIK, Zfp655) [6]   UniProt T UniProt UniProt  
  2.3.3.0.34 ZNF131 [6]   UniProt T23316 UniProt UniProt  
  2.3.3.0.34.1 ZNF131, isoform 1   UniProt T23324  
  2.3.3.0.34.2 ZNF131, isoform 2   UniProt T25958  
  2.3.3.0.34.3 ZNF131, isoform 3   UniProt T26363  
  2.3.3.0.35 PRDM14 [6] GGTCTCTAA UniProt T UniProt  
  2.3.3.0.37 ZNF575 (Zfp575) [6]   UniProt T20823 UniProt UniProt  
  2.3.3.0.38 ZBTB49 [7] UniProt T UniProt UniProt  
  2.3.3.0.38.1 ZBTB49, isoform 1   UniProt T  
  2.3.3.0.38.2 ZBTB49, isoform 2   UniProt T  
  2.3.3.0.38.3 ZBTB49, isoform 3   UniProt T  
  2.3.3.0.39 ZNF691 (Zfp691) [7]   UniProt T16890 UniProt UniProt  
  2.3.3.0.40 ZNF394 (ZKSCAN14, Zfp394, Zfp99) [7]   UniProt T20568 UniProt UniProt  
  2.3.3.0.41 ZNF449 (ZSCAN19, Zfp449) [7]   UniProt T UniProt UniProt  
  2.3.3.0.42 ZNF498 (ZSCAN25, Zfp498) [7]   UniProt T UniProt UniProt  
  2.3.3.0.43 ZSCAN30 (ZNF397OS, Zfp397OS) [7]   UniProt T UniProt UniProt  
  2.3.3.0.47 ZSCAN21 (ZFP38, ZNF38, Zipro1) [7]   UniProt T19587 UniProt  
  2.3.3.0.54 MYNN (OSZF, ZBTB31) [8]   UniProt T20033 UniProt UniProt  
  2.3.3.0.54.1 MYNN, isoform 1   UniProt T20032  
  2.3.3.0.54.2 MYNN, isoform 2   UniProt T20034  
  2.3.3.0.54.3 MYNN, isoform 3   UniProt T20035  
  2.3.3.0.55 ZBTB24 (ZNF450) [8]   UniProt T20221 UniProt UniProt  
  2.3.3.0.55.1 ZBTB24, isoform 1   UniProt T20220  
  2.3.3.0.55.2 ZBTB24, isoform 2   UniProt T20223  
  2.3.3.0.55.3 ZBTB24, isoform 3   UniProt T20222  
  2.3.3.0.57 ZFP92 [8]   UniProt T21421 UniProt UniProt  
  2.3.3.0.60 ZNF202 (ZKSCAN10, Zfp202) [8] GGGGTGGGGT UniProt T UniProt UniProt  
  2.3.3.0.69 ZNF187 (ZSCAN26, SRE-ZBP, Zfp187) [8]   UniProt T16850 UniProt UniProt  
  2.3.3.0.69.1 ZNF187, isoform 1   UniProt T16849  
  2.3.3.0.69.2 ZNF187, isoform 2   UniProt T16851  
  2.3.3.0.70 ZSCAN22 (HKR2, ZNF50) [8]   UniProt T UniProt UniProt  
  2.3.3.0.72 ZFP1 (ZNF475) [8]   UniProt T20280 UniProt UniProt  
  2.3.3.0.72.1 ZFP1, isoform 1   UniProt T20279  
  2.3.3.0.72.2 ZFP1, isoform 2   UniProt T20281  
  2.3.3.0.74 ZBTB16 (PLZF, ZNF145) [9] TAAAGTTTGATCTGTTC UniProt T08243 UniProt UniProt  
  2.3.3.0.75 GTF3A (TFIIIA) [9]   UniProt T19312 UniProt UniProt PDB
  2.3.3.0.76 ZFP64 [9]   UniProt T19406 UniProt UniProt PDB
  2.3.3.0.76.1 ZFP64, isoform 1   UniProt T19405  
  2.3.3.0.76.2 ZFP64, isoform 2   UniProt    
  2.3.3.0.76.3 ZFP64, isoform 3 [8]   UniProt    
  2.3.3.0.77 ZNF358 (Zfp358) [9]   UniProt T UniProt UniProt  
  2.3.3.0.79 ZNF263 (FPM315, ZKSCAN12, Zfp263) [9] GGGAGGAGG UniProt T22394 UniProt UniProt  
  2.3.3.0.81 ZNF192 (ZKSCAN8, LD5-1, Zfp192) [9]   UniProt T23327 UniProt UniProt  
  2.3.3.0.83 ZNF239 (HOK-2, MOK-2, Zfp239) [9]   UniProt T00510 UniProt UniProt  
  2.3.3.0.84 ZNF664 (ZFOC1, ZNF196, Zfp664) [9]   UniProt T20951 UniProt UniProt  
  2.3.3.0.92 GZF1 (ZBTB23, ZNF336) [10] TGCGCGTCTATA UniProt T08231 UniProt UniProt  
  2.3.3.0.93 ZNF408 (PFM14, PRDM17, Zfp408) [10]   UniProt T UniProt  
  2.3.3.0.94 ZNF648 (Zfp648) [10]   UniProt T UniProt UniProt  
  2.3.3.0.95 ZNF768 (Zfp768) [10]   UniProt T21043 UniProt UniProt  
  2.3.3.0.101 ZNF483 (ZKSCAN16) [11]   UniProt T UniProt  
  2.3.3.0.102 ZBTB48 (HKR3, ZNF855) [11]   UniProt T20247 UniProt UniProt PDB
  2.3.3.0.102.1 ZBTB48, isoform 1   UniProt T20246  
  2.3.3.0.102.2 ZBTB48, isoform 2   UniProt T20248  
  2.3.3.0.103 ZNF275 (Zfp275) [11]   UniProt T UniProt UniProt  
  2.3.3.0.114 ZNF354C (KID3) [11] CCACC UniProt T20198 UniProt UniProt  
  2.3.3.0.120 ZSCAN12 (ZNF305, ZNF96) [11]   UniProt T21524 UniProt UniProt  
  2.3.3.0.123 ZBTB40 [12]   UniProt T UniProt UniProt  
  2.3.3.0.125 ZNF454 (Zfp454) [12]   UniProt T UniProt UniProt  
  2.3.3.0.148 ZNF329 (Zfp329) [12]   UniProt T20524 UniProt UniProt  
  2.3.3.0.149 ZFP90 (ZNF756) [13]   UniProt T20318 UniProt UniProt  
  2.3.3.0.150 ZNF317 (Zfp317) [13]   UniProt T UniProt UniProt  
  2.3.3.0.152 MZF1 (ZNF42, ZSCAN6) [13] AGTGGGGA UniProt T08517 UniProt UniProt  
  2.3.3.0.157 ZNF879 (Zfp879) [13]   UniProt T UniProt UniProt  
  2.3.3.0.159 ZNF167 (ZKSCAN7, ZNF448, ZNF64, Zfp167) [13]   UniProt T UniProt UniProt  
  2.3.3.0.160 ZNF250 (ZNF647, Zfp647) [13]   UniProt T19444 UniProt UniProt  
  2.3.3.0.162 ZFP3 (ZNF752) [13]   UniProt T20298 UniProt UniProt  
  2.3.3.0.166 ZNF311 (ZFP31, Zscan20) [14]   UniProt T UniProt  
  2.3.3.0.166.1 ZNF311, isoform 1   UniProt T  
  2.3.3.0.166.2 ZNF311, isoform 2   UniProt T  
  2.3.3.0.167 ZNF551 (KOX23, Zfp551) [14]   UniProt T UniProt UniProt  
  2.3.3.0.169 ZSCAN10 (ZNF206) [14] GCGCATGCGC UniProt T18325 UniProt UniProt  
  2.3.3.0.169.1 ZSCAN10, isoform 1   UniProt T18322  
  2.3.3.0.169.2 ZSCAN10, isoform 2   UniProt T18324  
  2.3.3.0.169.3 ZSCAN10, isoform 3   UniProt T18326  
  2.3.3.0.174 ZNF287 (ZKSCAN13) [14]   UniProt T21498 UniProt UniProt  
  2.3.3.0.179 ZNF667 [15]   UniProt T20955 UniProt UniProt  
  2.3.3.0.192 ZFP28 [15]   UniProt T20285 UniProt UniProt PDB
  2.3.3.0.192.1 ZFP28, isoform 1   UniProt T20284  
  2.3.3.0.192.2 ZFP28, isoform 2   UniProt T20286  
  2.3.3.0.193 ZNF182 (KOX14, ZNF21, Zfp182) [15]   UniProt T20399 UniProt UniProt  
  2.3.3.0.195 PRDM5 (PFM2) [16] GGAGAGCAGG UniProt T20084 UniProt UniProt  
  2.3.3.0.196 RBAK (ZNF769) [16]   UniProt T UniProt UniProt  
  2.3.3.0.197 ZNF189 (Zfp189) [16]   UniProt T UniProt UniProt  
  2.3.3.0.215 ZNF569 (Zfp74) [18]   UniProt T20803 UniProt  
  2.3.3.0.219 ZNF271 (HZF7, ZNF-dp, ZNFEB, Zfp35) [19]   UniProt T00921 UniProt UniProt  
  2.3.3.0.220 ZNF184 (Zfp184) [19]   UniProt T20403 UniProt  
  2.3.3.0.231 ZFP62 [23]   UniProt T UniProt  
  2.3.3.0.231.1 ZFP62, isoform 1   UniProt T  
  2.3.3.0.231.2 ZFP62, isoform 2   UniProt T  
  2.3.3.0.231.3 ZFP62, isoform 3   UniProt T  
  2.3.4 Family: Factors with multiple dispersed zinc fingers    
  2.3.4.1 Subfamily: ZNF417-like factors    
  2.3.4.2 Subfamily: ZNF219-like factors CCCCCA  
  2.3.4.2.1 ZNF219 (Zfp219) [2+1+2+1]   UniProt T UniProt UniProt  
  2.3.4.2.2 ZNF536 (Zfp536) [2+4+1+2]   UniProt T20746 UniProt UniProt  
  2.3.4.2.3 ZNF516 (Zfp516) [2+5+1+1+1]   UniProt T20711 UniProt UniProt  
  2.3.4.2.4 ZNF217 (ZABC1) [1+3+1+2]   UniProt T UniProt UniProt  
  2.3.4.3 Subfamily: Sal-like factors    
  2.3.4.3.1 SALL1 (Spalt-1, Sal-1, ZNF794) [2+3+2+2]   UniProt T19221 UniProt UniProt  
  2.3.4.3.2 SALL2 (Spalt-2, Sal-2, ZNF795) [2+3+2]   UniProt T19225 UniProt UniProt  
  2.3.4.3.3 SALL3 (Sal-3, ZNF796) [2+3+2+2]   UniProt T20099 UniProt UniProt  
  2.3.4.3.3.1 SALL3, isoform 1 [2+3+2+2]   UniProt T20098  
  2.3.4.3.3.2 SALL3, isoform 2 [2+3]   UniProt T20100  
  2.3.4.3.4 SALL4 (ZNF797) [2+3+2+2]   UniProt T19229 UniProt UniProt  
  2.3.4.3.4.1 SALL4, isoform 1 (Sall4a) [2+3+2+2]   UniProt T19228  
  2.3.4.3.4.2 SALL4, isoform 2 (Sall4b) [2]   UniProt T26286  
  2.3.4.3.4.3 SALL4, isoform 3 (Sall4c) [2]   UniProt T26287  
  2.3.4.4 Subfamily: Ikaros TTGGGAAT  
  2.3.4.4.1 IKZF1 (IK1, IKAROS, Lyf-1, ZNFN1A1) [4+2]   UniProt T00479 UniProt UniProt  
  2.3.4.4.1.1 IKZF1, isoform I [3+2]   UniProt T01469  
  2.3.4.4.1.2 IKZF1, isoform II [3+2]   UniProt T01470  
  2.3.4.4.1.3 IKZF1, isoform III [3+2]   UniProt T01471  
  2.3.4.4.1.4 IKZF1, isoform IV [1+2]   UniProt T01472  
  2.3.4.4.1.5 IKZF1, isoform V [2]   UniProt T01473  
  2.3.4.4.1.6 IKZF1, isoform VI   UniProt T19007  
  2.3.4.4.2 IKZF2 (HELIOS, ZNFN1A2, Zfpn1a2) [4+2]   UniProt T06012 UniProt UniProt  
  2.3.4.4.2.1 IKZF2, isoform B   UniProt T11158  
  2.3.4.4.2.2 IKZF2, isoform A [3+2]   UniProt T19008  
  2.3.4.4.3 IKZF3 (Aiolos, ZNFN1A3) [4+2]   UniProt T05979 UniProt UniProt  
  2.3.4.4.4 IKZF4 (EOS, ZNFN1A4, Zfpn1a4) [4+2]   UniProt T19017 UniProt UniProt  
  2.3.4.4.4.1 IKZF4, isoform 1   UniProt T19016  
  2.3.4.4.4.2 IKZF4, isoform 2   UniProt T26152  
  2.3.4.4.4.3 IKZF4, isoform 3   UniProt T26153  
  2.3.4.4.4.4 IKZF4, isoform 4   UniProt T26154  
  2.3.4.4.5 IKZF5 (Pegasus, ZNFN1A5, Zfpn1a5) [3+2]   UniProt T19022 UniProt UniProt  
  2.3.4.4.5.1 IKZF5, isoform 1   UniProt T19020  
  2.3.4.4.5.2 IKZF5, isoform 2   UniProt T19021  
  2.3.4.4.5.3 IKZF5, isoform 3   UniProt T26155  
  2.3.4.5 Subfamily: HIV EP-factors GGGACTTTCC  
  2.3.4.5.1 HIV-EP1 (ZNF40, PRDII-BF1, MBP-1, CIRIP, GAAP) [2+1+2]   UniProt T00007 UniProt UniProtF  
  2.3.4.5.2 HIV-EP2 (MBP-2, ZNF40B) [2+2]   UniProt T16993 UniProt UniProt  
  2.3.4.5.3 HIV-EP3 (KBP1, KRC, ZAS3) [2+1+2]   UniProt T02315 UniProt UniProt  
  2.3.4.6 Subfamily: ZBTB1-like factors    
  2.3.4.6.1 ZBTB1 [1+1+6]   UniProt T20252 UniProt UniProt  
  2.3.4.6.2 ZBTB2 (ZNF437) [1+3]   UniProt T UniProt UniProt  
  2.3.4.6.3 ZBTB25 (KUP, ZNF46) [1+1]   UniProt T UniProt UniProt  
  2.3.4.7 Subfamily: RLF-like factors    
  2.3.4.7.1 RLF [1+5+1+2+4+1]   UniProtF T UniProt  
  2.3.4.7.2 ZNF292 (Zfp292) [1+5+1+1+2+4+1]   UniProt T UniProt UniProt PDB
  2.3.4.7.2.1 ZNF292, isoform 1   UniProt T  
  2.3.4.7.2.2 ZNF292, isoform 2   UniProt T  
  2.3.4.7.3 ZNF654 (Zfp654) [1+4]   UniProt T20939 UniProt UniProt  
  2.3.4.8 Subfamily: MAZ-like factors GGGGAGGG  
  2.3.4.8.1 MAZ (Zif87, ZNF801) [1+5]   UniProt T02303 UniProt UniProt  
  2.3.4.8.2 VEZF1 (DB1, ZNF161) [1+5]   UniProt T10444 UniProt UniProt  
  2.3.4.8.3 PATZ1 (RIAZ, ZBTB19, ZNF278, ZSG) [1+5+1]   UniProt T04796 UniProt UniProt PDB
  2.3.4.9 Subfamily: ZNF532-like factors    
  2.3.4.9.1 ZNF532 (Zfp532) [1+6+3+2]   UniProt T20741 UniProt UniProt  
  2.3.4.9.1.1 ZNF532, isoform 1   UniProt T20740  
  2.3.4.9.1.2 ZNF532, isoform 2   UniProt T20742  
  2.3.4.9.2 ZNF592 (Zfp592) [2+6+3+2]   UniProt T19534 UniProt UniProt  
  2.3.4.9.3 ZNF687 (Zfp687) [1+5+2+2]   UniProt T20988 UniProt UniProt  
  2.3.4.9.3.1 ZNF687, isoform 1   UniProt T20987  
  2.3.4.9.3.2 ZNF687, isoform 2 [1+5+2]   UniProt T20989  
  2.3.4.9.3.3 ZNF687, isoform 3 [1+5+2]   UniProt T20990  
  2.3.4.10 Subfamily: ZNF512-factors    
  2.3.4.10.1 ZNF512 (Zfp512) [1+1+2]   UniProt T20697 UniProt UniProt PDB
  2.3.4.10.2 ZNF512B (Zfp512b) [2+3+2]   UniProtF T UniProt UniProt  
  2.3.4.11 Subfamily: ZNF658-factors    
  2.3.4.12 Subfamily: ZNF423-like factors GCACCCAAGGGTGC  
  2.3.4.12.1 ZNF423 (OAZ, Zfp423) [1+7+5+7+10]   UniProt T06599 UniProt UniProt  
  2.3.4.12.1.1 ZNF423, isoform 1   UniProt T15869  
  2.3.4.12.1.2 ZNF423, isoform 2   UniProt T15870  
  2.3.4.12.2 ZNF521 (EHZF, LIP3, Zpf521) [1+7+5+7+5+5]   UniProt T20719 UniProt UniProt  
  2.3.4.12.2.1 ZNF521, isoform 1   UniProt T20718  
  2.3.4.12.2.2 ZNF521, isoform 2   UniProt T20720  
  2.3.4.13 Subfamily: ZNF639-like factors    
  2.3.4.13.1 ZNF639 (ZASC1, Zfp639) [4+4]   UniProt T UniProt UniProt  
  2.3.4.13.2 ZNF711 (CMPX1, ZNF6, Zfp711) [1+10]   UniProt T UniProt UniProt  
  2.3.4.14 Subfamily: Evi-1-like factors ACAAGATAA  
  2.3.4.14.1 EVI-1 (MECOM) [7+3]   UniProt T00273 UniProt UniProt  
  2.3.4.14.1.1 EVI-1, isoform 1   UniProt T10211  
  2.3.4.14.1.2 EVI-1, isoform 2   UniProt T25985  
  2.3.4.14.2 PRDM16 (MEL1, PFM13) [7+3]   UniProt T27849 UniProt UniProt  
  2.3.4.14.2.1 PRDM16, isoform 1   UniProt T27353  
  2.3.4.14.2.2 PRDM16, isoform 2 (MEL1L)   UniProt T27927  
  2.3.4.14.2.3 PRDM16, isoform 3   UniProt T27354  
  2.3.4.15 Subfamily: BCL11    
  2.3.4.15.1 BCL11A (CTIP1, EVI9, ZNF856) [1+2]   UniProt T27831 UniProt UniProt  
  2.3.4.15.1.1 BCL11A, isoform 1 (a) [1+2]   UniProt T27221  
  2.3.4.15.1.2 BCL11A, isoform 2 (b) [2]   UniProt T27873  
  2.3.4.15.1.3 BCL11A, isoform 3 (c) [1]   UniProt T27874  
  2.3.4.15.1.4 BCL11A, isoform 4 [2]   UniProt T27875  
  2.3.4.15.1.5 BCL11A, isoform 5 [1]   UniProt T27222  
  2.3.4.15.1.6 BCL11A, isoform 6 [1]   UniProt T27876  
  2.3.4.15.1.7 BCL11A, isoform 7 [0]   UniProt T27877  
  2.3.4.15.1.8 BCL11A, isoform 8 [2]   UniProt T27878  
  2.3.4.15.2 BCL11B (CTIP2, RIT1) [1+2+3]   UniProt T UniProt UniProt  
  2.3.4.15.2.1 BCL11B, isoform 1 (α)   UniProt T  
  2.3.4.15.2.2 BCL11B, isoform 2 (β)   UniProt T  
  2.3.4.15.2.3 BCL11B, isoform 3 (γ)   UniProt T  
  2.3.4.15.3 ZNF296 (ZNF342) [1+2+3]   UniProt T UniProt UniProt  
  2.3.4.16 Subfamily: Insulinoma-associated proteins    
  2.3.4.16.1 INSM1 (IA-1) [2+1+2]   UniProt T16447 UniProt PDB
  2.3.4.16.2 INSM2 (IA-6) [2+3]   UniProt T21510 UniProt UniProt  
  2.3.4.17 Subfamily: Hypermethylated in Cancer proteins GGGTGCCCGG  
  2.3.4.17.1 HIC1 (ZBTB29) [1+4] UniProt T06430 UniProt UniProtF  
  2.3.4.17.2 HIC2 (HRG22, ZBTB30) [1+4] UniProt T18974 UniProt UniProt  
  2.3.4.17.2.1 HIC2, isoform 1   UniProt T18976  
  2.3.4.17.2.2 HIC2, isoform 2 [1+1]   UniProt T18975  
  2.3.4.18 Subfamily: ZNF518    
  2.3.4.18.1 ZNF518A (Zfp518a) [4+1]   UniProt T UniProt UniProt  
  2.3.4.18.2 ZNF518B (Zfp518b) [2+1]   UniProt T21344 UniProt UniProt  
  2.3.4.19 Subfamily: Basonuclin    
  2.3.4.19.1 BNC1 [2+2+2]   UniProt T05192 UniProt UniProt  
  2.3.4.19.2 BNC2 [1+1+2]   UniProt T UniProt UniProt  
  2.3.4.19.2.1 BNC2, isoform 1   UniProt T  
  2.3.4.19.2.2 BNC2, isoform 2   UniProt T  
  2.3.4.20 Subfamily: TRERF1-like factors    
  2.3.4.20.1 TRERF1 (BCAR2, RAPA, TREP132) = 3.5.1.3.9 [1+1+1]   UniProt T16489 UniProt UniProt  
  2.3.4.20.1.1 TRERF1, isoform 1   UniProt T16488  
  2.3.4.20.1.2 TRERF1, isoform 2   UniProt T16490  
  2.3.4.20.1.3 TRERF1, isoform 3 [1]   UniProt T16491  
  2.3.4.20.1.4 TRERF1, isoform 4   UniProt T16492  
  2.3.4.20.2 ZNF541 (Ship1, Zfp541) [3+1+1] = 3.5.1.3.10   UniProt T UniProt UniProt  
  2.3.4.20.2.1 ZNF541, isoform 1   UniProt T  
  2.3.4.20.2.2 ZNF541, isoform 2   UniProt T  
  2.3.4.21 Subfamily: HINFP-like factors CGGACGTT  
  2.3.4.21.1 HINFP (MIZF, ZNF743) [1+8] UniProt T UniProt UniProt  
  2.3.4.21.2 ZFAT (ZFAT1, ZNF406, Zfp406) [1+1+7+10]   UniProt T20270 UniProt UniProt PDB
  2.3.4.21.2.1 ZFAT, isoform 1   UniProt T20269  
  2.3.4.21.2.2 ZFAT, isoform 2   UniProt T20271  
  2.3.4.22 Subfamily: ZNF526-like factors    
  2.3.4.22.1 ZNF526 (Zfp526) [1+2+1+9]   UniProt T20728 UniProt UniProt  
  2.3.4.22.1.1 ZNF526, isoform 1   UniProt T20727  
  2.3.4.22.1.2 ZNF526, isoform 2 [1+2+1+4]   UniProt T20729  
  2.3.4.22.2 ZNF574 [3+1+4+8+4]   UniProt T20819 UniProt UniProt  
  2.3.4.23 Subfamily: ZNF319-like factors    
  2.3.4.23.1 ZNF319 (Zfp319) [3+13]   UniProt T20516 UniProt UniProt  
  2.3.4.23.2 ZNF786 (Zfp786) [2+14]   UniProt T21088 UniProt UniProt  
  2.3.4.24 Subfamily: ZNF134-like factors    
  2.3.4.25 Subfamily: ZNF37A-like factors    
  2.3.4.25.3 ZNF248 (Zfp248) [1+7]   UniProt T UniProt UniProt  
  2.3.4.25.4 ZNF334 (Zfp334) [9+5]   UniProt T UniProt UniProt  
  2.3.4.25.5 ZNF382 (KS1, Zfp382) [1+9]   UniProt T20560 UniProt UniProt  
  2.3.4.0 Subfamily: unclassified    
  2.3.4.0.1 CASZ1 (CST, SRG, ZNF693) [3+1+1+3]   UniProt T19862 UniProt UniProt  
  2.3.4.0.1.1 CASZ1, isoform 1   UniProt T19861  
  2.3.4.0.1.2 CASZ1, isoform 2 [3+1]   UniProt T19863  
  2.3.4.0.2 ZNF335 (NIF-1, Zfp335) [1+8+4]   UniProt T UniProt UniProt  
  2.3.4.0.3 PRDM8 (PFM5) [1+2]   UniProt T20089 UniProt UniProt  
  2.3.4.0.4 WIZ (ZNF803) [4+2+1+1+1+1+1]   UniProt T UniProt UniProt  
  2.3.4.0.4.1 WIZ, isoform L   UniProt T  
  2.3.4.0.4.2 WIZ, isoform S [1+1+1+1+1+1]   UniProt T  
  2.3.4.0.4.3 WIZ, isoform 2 [1+1+1+1+1]   UniProt T  
  2.3.4.0.4.4 WIZ, isoform 3 [4]   UniProt T  
  2.3.4.0.5 ZNF469 [1+1+3]   UniProtF T UniProt UniProt  
  2.3.4.0.6 ZFPM1 (FOG1, ZFN89A) = 2.7.2.0.1 [3+1]   UniProt T02334 UniProt UniProt  
  2.3.4.0.7 ZBTB4 (KAISO-L1) [1+3+2]   UniProt T UniProt UniProt PDB
  2.3.4.0.8 ZBTB38 [2+3+5]   UniProt T UniProt UniProt  
  2.3.4.0.9 ZBTB39 [2+3+3]   UniProt T UniProt UniProt  
  2.3.4.0.10 ZNF295 (ZBTB21) [2+1+2+2+1]   UniProt T UniProt PDB
  2.3.4.0.11 ZNF827 [3+4+2]   UniProt T21121 UniProt  
  2.3.4.0.11.1 ZNF827, isoform 1   UniProt T21120  
  2.3.4.0.11.2 ZNF827, isoform 2 [2]   UniProt T21122  
  2.3.4.0.12 PRDM13 (PFM10) [1+3]   UniProt T UniProt UniProt  
  2.3.4.0.12.1 PRDM13, isoform 1   UniProt T  
  2.3.4.0.12.2 PRDM13, isoform 2   UniProt T  
  2.3.4.0.13 ZNF646 (PFM10, Zfp646) [1+3]   UniProt T UniProt UniProtF  
  2.3.4.0.14 ZNF579 (Zfp579) [3+2+3]   UniProt T20833 UniProt UniProt  
  2.3.4.0.15 RREB1 (FINB, Zep-1, LZ321) [3+2+1+5+1+1+2] CCCCAAACACCCCC UniProt T17652 UniProt UniProt  
  2.3.4.0.15.1 RREB1, isoform 1   UniProt T17651  
  2.3.4.0.15.2 RREB1, isoform 2 [3+2+1+5+1+1+2]]   UniProt T17653  
  2.3.4.0.15.3 RREB1, isoform 3 [3+2+1+5+2+1+2]   UniProt T17654  
  2.3.4.0.15.4 RREB1, isoform 4 [3+2+1+5+1]   UniProt T17655  
  2.3.4.0.16 PRDM2 (G3B, MTB-ZF, MTE-BP, KMT8, RIZ) [2+1+3+1+1] GTCATATGAC UniProt T UniProt UniProt  
  2.3.4.0.17 ZNF800 (Zfp800) [1+3+2+1]   UniProt T21110 UniProt UniProt  
  2.3.4.0.18 ZNF618 [3+1]   UniProt T21454 UniProt UniProtF  
  2.3.4.0.18.1 ZNF618, isoform 1   UniProt T21453  
  2.3.4.0.18.2 ZNF618, isoform 2 [3]   UniProt T21455  
  2.3.4.0.19 ZNF277 (NRIF4, ZNF277P, Zfp277) [1+1]   UniProt T UniProt UniProt  
  2.3.4.0.20 TRPS1 (GC79) = 2.2.1.2.13 [1+1+3+2]   UniProt T19349 UniProt UniProt  
  2.3.4.0.21 ZNF451 (COASTER, Zfp451) [1+3+2+3+2]   UniProt T19504 UniProt UniProt  
  2.3.4.0.22 ZNF438 [3+1]   UniProt T UniProt UniProt  
  2.3.4.0.23 PEG3 (ZSCAN24) [4+1+5+2]   UniProt T UniProt UniProt  
  2.3.4.0.23.1 PEG3, isoform 1   UniProt    
  2.3.4.0.23.2 PEG3, isoform 2 [2]   UniProt T22527  
  2.3.4.0.24 ZNF507 (Zfp507) [2+1+3+2+1]   UniProt T20688 UniProt UniProt  
  2.3.4.0.25 ZNF236 (Zfp236) [9+4+4+4+4+5]   UniProt T UniProt UniProt  
  2.3.4.0.26 ZNF770 (Zfp770) [3+3+1+2+2]   UniProt T21047 UniProt UniProt  
  2.3.4.0.27 REST (NRSF, XBR) [1+7+1] TTCAGCACCACGGACAGCGCC UniProt T05934 UniProt UniProt  
  2.3.4.0.27.1 REST, isoform 1   UniProt T09307  
  2.3.4.0.27.2 REST, isoform 2 (N16, REST4) [1+4]   UniProt T10486  
  2.3.4.0.27.3 REST, isoform 3 (N28) [1+4]   UniProt T26267  
  2.3.4.0.28 ZFP57 (ZNF698) [4+3] TTCAGCACCACGGACAGCGCC UniProt T20308 UniProt UniProt PDB
  2.3.4.0.28.1 ZFP57, isoform 1   UniProt T20307  
  2.3.4.0.28.2 ZFP57, isoform 2   UniProt T20309  
  2.3.4.0.29 ZNF8 (HF.18, Zfp128) [6+1]   UniProt T22794 UniProt UniProt  
  2.3.4.0.30 ZNF597 (Zfp597) [4+3]   UniProt T UniProt UniProt  
  2.3.4.0.31 PRDM4 (PFM1) [1+5] UniProt T18699 UniProt UniProt  
  2.3.4.0.32 PRDM15 (ZNF298) [1+15]   UniProt T UniProt UniProt  
  2.3.4.0.33 ZBTB41 (FRBZ1) [1+13]   UniProt T20243 UniProt UniProt  
  2.3.4.0.34 PRDM10 (PFM7, TRIS) [1+9]   UniProt T UniProt UniProt  
  2.3.4.0.34.1 PRDM10, isoform 1   UniProt    
  2.3.4.0.34.2 PRDM10, isoform 2 [0]   UniProt    
  2.3.4.0.35 ZNF341 (Zfp341) [1+2+9]   UniProt T UniProt UniProtF  
  2.3.4.0.36 ZNF513 (Zfp513) [3+5]   UniProt T20703 UniProt UniProt  
  2.3.4.0.36.1 ZNF513, isoform 1   UniProt T20702  
  2.3.4.0.36.2 ZNF513, isoform 2   UniProt T20704  
  2.3.4.0.37 ZNF142 (Zfp142) [14+17]   UniProt T UniProt UniProt  
  2.3.4.0.38 FIZ1 (ZNF798) [4+2+5]   UniProt T UniProt UniProt  
  2.3.4.0.39 ZNF628 (Zfp628) [7+2+6] CAAGGTTGGTTGC UniProt T08324 UniProt UniProt  
  2.3.4.0.39.1 ZNF628, isoform 1   UniProt T08319  
  2.3.4.0.39.2 ZNF628, isoform 2 [7]   UniProt T26369  
  2.3.4.0.40 ZNF784 (Zfp784) [3+3] UniProt T21081 UniProt UniProt  
  2.3.4.0.41 ZNF697 (Zfp697) [1+10]   UniProt T21002 UniProt UniProt  
  2.3.4.0.42 ZKSCAN5 (ZFP95) [4+9]   UniProt T21526 UniProt UniProt  
  2.3.4.0.43 ZNF316 (Zfp316) [6+9]   UniProt T20264 UniProt UniProt  
  2.3.4.0.44 ZNF775 (Zfp775) [4+4+3]   UniProt T21063 UniProt UniProt  
  2.3.4.0.45 ZNF467 (Zfp467) [7+5]   UniProt T19511 UniProt UniProt  
  2.3.4.0.46 ZNF787 (TTF-I-IP20, Zfp787) [5+2]   UniProt T21090 UniProt UniProt  
  2.3.4.0.48 ZNF48 (ZNF553, Zfp48, Zfp553) [8+2+2]   UniProt T21192 UniProt UniProt  
  2.3.4.0.49 ZNF629 (ZNF65, Zfp629) [15+3+1]   UniProt T20905 UniProt UniProt  
  2.3.4.0.50 ZNF668 (Zfp668) [13+3]   UniProt T20959 UniProt UniProt  
  2.3.4.0.53 ZNF445 (ZKSCAN15, ZNF168, Zfp445) [12+2]   UniProt T20627 UniProt UniProt  
  2.3.4.0.56 ZSCAN20 (KOX29, ZNF31, ZNF360) [4+6]   UniProt T UniProt UniProt  
  2.3.4.0.56.1 ZSCAN20, isoform 1   UniProt T  
  2.3.4.0.56.2 ZSCAN20, isoform 2   UniProt T  
  2.3.4.0.64 ZNF426 (Zfp426) [1+11]   UniProt T19487 UniProt UniProt  
  2.3.4.0.65 ZFP112 (ZNF112, ZNF228) [1+16]   UniProt T21386 UniProt UniProt  
  2.3.4.0.65.1 ZFP112, isoform 1   UniProt T21385  
  2.3.4.0.65.2 ZFP112, isoform 2   UniProt T21387  
  2.3.4.0.67 ZNF606 (ZNF328, Zfp606) [2+14]   UniProt T UniProt UniProt  
  2.3.4.0.71 PRDM9 (PFM6) [1+12]   UniProt T UniProt UniProt  
  2.3.4.0.71.1 PRDM9, isoform 1 (Meisetz)   UniProt    
  2.3.4.0.71.2 PRDM9, isoform 2 (Meisetz-S1) [0]   UniProt    
  2.3.4.0.71.3 PRDM9, isoform 3 (Meisetz-S2) [0]   UniProt    
  2.3.4.0.71.4 PRDM9, isoform 4 [0]   UniProt    
  2.3.4.0.72 ZBTB17 (MIZ1, ZNF151, ZNF60) [12+1]   UniProt T17704 UniProt UniProt  
  2.3.4.0.73 ZNF407 (Zfp407) [3+3+1+2+2+11]   UniProt T UniProt UniProt  
  2.3.4.0.74 E4F1 (p120E4F, p50E4F) [3+6] TACGTCAC UniProt T02287 UniProt UniProt  
  2.3.4.0.74.1 E4F1, isoform 1   UniProt T14957  
  2.3.4.0.74.2 E4F1, isoform 2   UniProt T26091  
  2.3.4.0.74.3 E4F1, isoform 3   UniProt T26092  
  2.3.4.0.74.4 E4F1, isoform 4 [3+1]   UniProt T26093  
  2.3.4.0.74.5 E4F1, isoform 5 [2+6]   UniProt T26094  
  2.3.4.0.75 ZNF462 (Zfp462) [1+2+2+1+3+1+1+3+2+1+4+5+1]   UniProt T UniProt UniProt PDB
  2.3.4.0.76 ZNF644 (ZEP2, Zfp644) [5+1+1]   UniProt T UniProt UniProt  
  2.3.4.0.77 ADNP (ADNP1) = 3.1.8.1.1 [4+3+2]   UniProt T21522 UniProt UniProt  
  2.3.4.0.78 ADNP2 (ZNF508) = 3.1.8.1.2 [1+1+1+1]   UniProt T19732 UniProt UniProt  
  2.3.5 Family: BED zinc finger factors TGTCGCGACA  
  2.3.5.0.3 ZBED3   UniProt T UniProt UniProt  
  2.3.5.0.4 ZBED4   UniProt T UniProt UniProt  
  2.3.5.0.6 ZBED6 (MGR)   UniProt T17368 UniProt  
  2.3.5.0.6.1 ZBED6, isoform 1 (a)   UniProt T17346  
  2.3.5.0.6.2 ZBED6, isoform 2 (b)   UniProt T17365  
  2.4 Class: C6 zinc cluster factors TRANSFAC class description
 
  2.5 Class: DM-type intertwined zinc finger factors Class description Further information
  2.5.1 Family: DMRT TGATACATTGTTGC  
  2.5.1.0.1 DMRT1   UniProt T10713 UniProt UniProt  
  2.5.1.0.1.1 DMRT1, isoform 1 (a)   UniProt T10712  
  2.5.1.0.1.2 DMRT1, isoform 2 (b)   UniProt T26413  
  2.5.1.0.1.3 DMRT1, isoform 3 (d)   UniProt T26414  
  2.5.1.0.1.4 DMRT1, isoform 4 (c)   UniProt T26415  
  2.5.1.0.2 DMRT2   UniProt T10722 UniProt UniProt  
  2.5.1.0.3 DMRT3   UniProt T10724 UniProt UniProt  
  2.5.1.0.4 DMRTA1 (DMRT4)   UniProt T10728 UniProt UniProt  
  2.5.1.0.5 DMRTA2 (DMRT5)   UniProt T10732 UniProt UniProt  
  2.5.1.0.6 DMRTB1   UniProt T10730 UniProt UniProt  
  2.5.1.0.7 DMRTC2   UniProt T10726 UniProt UniProt  
  2.5.1.0.8 DMRTC1a (no DM domain!)   UniProt T UniProt UniProt  
  2.5.1.0.8.1 DMRTC1a, isoform 1 (c)   UniProt T  
  2.5.1.0.8.2 DMRTC1a, isoform 2 (b)   UniProt T  
  2.5.1.0.8.3 DMRTC1a, isoform 3 (a)   UniProt T  
  2.5.1.0.9 DMRTC1b (no DM domain!)   UniProt T UniProt UniProt  
  2.5.1.0.10 DMRTC1c (no DM domain!)   UniProt T UniProt    
  2.6 Class: CXXC zinc finger factors Class description Further information
  2.6.1 Family: CpG-binding proteins    
  2.6.1.0.1 CpG-binding protein (CXXC1, CFP1, CGBP, PCCX1, PHF18)   UniProt T19901 UniProt UniProt  
  2.6.1.0.2 MBD1 (CXXC3, PCM1)   UniProt T UniProt UniProt  
  2.6.1.0.2.1 MBD1, isoform 1 (a)   UniProt T  
  2.6.1.0.2.2 MBD1, isoform 2 (b)   UniProt T  
  2.6.1.0.2.3 MBD1, isoform 3 (d)   UniProt T  
  2.6.1.0.2.4 MBD1, isoform 4   UniProt T  
  2.6.1.0.2.5 MBD1, isoform 5   UniProt T  
  2.6.1.0.3 TET1 (CXXC6, LCX)   UniProt T UniProt UniProt  
  2.6.1.0.4 MLL (CXXC7, ALL1, HRX, HTRX, KMT2A, MLL1, TRX1)   UniProt T27835 UniProt UniProt PDB
  2.6.1.0.4.1 MLL, isoform 1   UniProt T27239  
  2.6.1.0.4.2 MLL, isoform 14P-18B   UniProt T27889  
  2.6.1.0.5 KDM2A (CXXC8, FBL7, FBXL11, JHDM1A)   UniProt T27843 UniProt UniProt  
  2.6.1.0.5.1 KDM2A, isoform 1   UniProt T27346  
  2.6.1.0.5.2 KDM2A, isoform 2   UniProt T27920  
  2.6.1.0.5.3 KDM2A, isoform 3   UniProt T27921  
  2.6.1.0.6 DNMT1 (CXXC9, AIM, DNMT)   UniProt T27826 UniProt UniProt  
  2.6.1.0.6.1 DNMT1, isoform 1 (long)   UniProt T27185  
  2.6.1.0.6.2 DNMT1, isoform 2 (short)   UniProt T27865  
  2.6.1.0.7 MLL2 (HRX2, KMT2B, WBP7, MLL4, TRX2)   UniProt T19083 UniProt UniProt  
  2.7 Class: C2HC zinc finger factors Class description Further information
  2.7.1 Family: Myelin transcription factor-related proteins AAGTT  
  2.7.1.0.1 MYT1 (MyT1, MTF1, MYTI, PLPB1) [7]   UniProt T22947 UniProt UniProt PDB
  2.7.1.0.1.1 MYT1, isoform 1 (NZF-2b)   UniProt T25788  
  2.7.1.0.1.2 MYT1, isoform 2 (NZF-2a) [6]   UniProt T25789  
  2.7.1.0.1.3 MYT1, isoform 3 [6]   UniProt T26205  
  2.7.1.0.2 MYT1L (MyT1L, NZF-1) [6]   UniProt T27828 UniProt UniProt  
  2.7.1.0.2.1 MYT1L, isoform 1   UniProt T27211  
  2.7.1.0.2.2 MYT1L, isoform 2   UniProt T27212  
  2.7.1.0.2.3 MYT1L, isoform 3 [0]   UniProt    
  2.7.1.0.2.4 MYT1L, isoform 4 [2]   UniProt    
  2.7.1.0.3 ST18 (ZNF387, NZF-3) [6]   UniProt T UniProt UniProt  
  2.7.2 Family: Friend of GATA proteins    
  2.7.2.0.1 FOG1 (ZFPM1, ZFN89A) [5] = 2.3.4.0.6   UniProt T02334 UniProt UniProt  
  2.7.2.0.2 FOG2 (ZFPM2, ZFN89B) [5] = 2.3.2.4.6   UniProt T18922 UniProt UniProtF  
  2.7.3 Family: Histone acetyltransferases with C2HC zinc finger    
  2.7.3.0.1 MYST1 (KAT8, TIP60 protein 1) [1]   UniProt T27842 UniProt UniProt  
  2.7.3.0.1.1 MYST1, isoform 1   UniProt T27345  
  2.7.3.0.1.2 MYST1, isoform 2 [0]   UniProt T27919  
  2.7.3.0.2 MYST2 (KAT7, TIP60 protein 2, HBO1, HBOa) [1]   UniProt T UniProt UniProt  
  2.7.3.0.2.1 MYST2, isoform 1   UniProt T  
  2.7.3.0.2.2 MYST2, isoform 2   UniProt T  
  2.7.3.0.2.3 MYST2, isoform 3   UniProt T  
  2.7.3.0.2.4 MYST2, isoform 4   UniProt T  
  2.7.3.0.2.5 MYST2, isoform 5   UniProt T  
  2.7.3.0.3 MYST3 (KAT6A, TIP60 protein 3, RUNXBP2, ZNF220, MOZ) [1]   UniProt T UniProt UniProt  
  2.7.3.0.4 MYST4 (KAT6B, TIP60 protein 4, MORF, MOZ2) [1]   UniProt T UniProt  
  2.7.3.0.4.1 MYST4, isoform 1   UniProt T  
  2.7.3.0.4.2 MYST4, isoform 2   UniProt T  
  2.7.3.0.5 KAT5 (HTATIP, TIP60) [1]   UniProt T27824 UniProt UniProt  
  2.7.3.0.5.1 KAT5, isoform 1   UniProt T27282  
  2.7.3.0.5.2 KAT5, isoform 2   UniProt T27283  
  2.7.3.0.5.3 KAT5, isoform 3   UniProt T27284  
  2.7.3.0.5.4 KAT5, isoform 4   UniProt T27944  
  2.7.4 Family: Lethal(3)malignant brain tumor-related proteins    
  2.7.4.0.1 L3MBTL1 (L3MBT, L3MBTL) [1]   UniProt T UniProt UniProt  
  2.7.5 Family: LYAR-related proteins    
  2.7.5.0.1 LYAR (PNAS-5) [2]   UniProt T UniProt UniProt  
  2.8 Class: C3H zinc finger factors Class description Further information
  2.8.1 Family: ZC3H8-related factors    
  2.8.1.0.1 ZC3H8 (ZC3HDC8, FLIZ1) [3]   UniProt T UniProt UniProt  
  2.8.1.0.2 ZC3H4 [3]   UniProt T UniProt UniProt  
  2.8.1.0.2.1 ZC3H4, isoform 1   UniProt T  
  2.8.1.0.2.2 ZC3H4, isoform 2   UniProt T  
  2.8.1.0.3 ZC3H6 (ZC3HDC6) [3]   UniProt T UniProt UniProt  
  2.8.1.0.3.1 ZC3H6, isoform 1   UniProt    
  2.8.1.0.3.2 ZC3H6, isoform 2 [0]   UniProt    
  2.8.2 Family: ZGPAT-related factors    
  2.8.2.0.1 ZGPAT (GPATC6, GPATCH6, ZC3H9, ZC3HDC9, ZIP) [1]   UniProt T27855 UniProt UniProt  
  2.8.3 Family: RC3H-related factors    
  2.8.3.0.1 RC3H2 (Roquin-2, MNAB, RNF164) [1]   UniProt T UniProt UniProt  
  2.8.4 Family: CNOT4-related factors    
  2.8.4.0.1 CNOT4 (NOT4) [1]   UniProt T27838 UniProt UniProt  
  2.8.4.0.1.1 CNOT4, isoform 1   UniProt T27257  
  2.8.4.0.1.2 CNOT4, isoform 2   UniProt T27258  
  2.8.4.0.1.3 CNOT4, isoform 3   UniProt T27940  
  2.9 Class: C2CH THAP-type zinc finger factors Class description Further information
  2.9.1 Family: THAP-related factors TTGCCCGTACT  
  2.9.1.0.1 THAP1   UniProt T UniProt UniProt PDB
  2.9.1.0.2 THAP2   UniProt T UniProt UniProt  
  2.9.1.0.3 THAP3   UniProt T UniProt UniProt  
  2.9.1.0.4 THAP4 (CGI-36, PP238)   UniProt T UniProt UniProt  
  2.9.1.0.4.1 THAP4, isoform 1   UniProt T  
  2.9.1.0.4.2 THAP4, isoform 2   UniProt T  
  2.9.1.0.7 THAP7   UniProt T UniProt UniProt  
  2.9.1.0.11 THAP11 (HRIHFB2206)   UniProt T UniProt UniProt  
  2.9.1.0.12 PRKRIR (P52RIPK, DAP4, THAP0)   UniProt T UniProt UniProt  

3 Superclass: Helix-turn-helix domains TRANSFAC class description
  3.1 Class: Homeo domain factors TRANSFAC class description Further information
  3.1.1 Family: HOX-related factors    
  3.1.1.1 Subfamily: HOX1 TAATTA  
  3.1.1.1.1 Hox-A1 (HOX1F, ERA-1) UniProt T01696 UniProt UniProt  
  3.1.1.1.1.1 Hox-A1, isoform 1 (ERA-1-993)   UniProt    
  3.1.1.1.1.2 Hox-A1, isoform 2 (ERA-1-399)   UniProt    
  3.1.1.1.2 Hox-B1 (HOX2I)   UniProt T01720 UniProt UniProt PDB
  3.1.1.1.3 Hox-D1 (HOX4G)   UniProt T01750 UniProt UniProt  
  3.1.1.2 Subfamily: HOX2 TAATTA  
  3.1.1.2.1 Hox-A2 (HOX1K) UniProt T13907 UniProt UniProt  
  3.1.1.2.2 Hox-B2 (HOX2H) UniProt T19758 UniProt UniProt  
  3.1.1.3 Subfamily: HOX3 TAATTA  
  3.1.1.3.1 Hox-A3 (HOX1E)   UniProt T00378 UniProt UniProt  
  3.1.1.3.2 Hox-B3 (HOX2G) UniProt T01724 UniProt UniProt  
  3.1.1.3.3 Hox-D3 (HOX4A) UniProt T03339 UniProt UniProt  
  3.1.1.4 Subfamily: HOX4 TTAATTAA  
  3.1.1.4.1 Hox-A4 (HOX1D)   UniProt T01701 UniProt UniProtF  
  3.1.1.4.2 Hox-B4 (HOX2F)   UniProt T01728 UniProt UniProt  
  3.1.1.4.3 Hox-C4 (HOX3E)   UniProt T03340 UniProt UniProt  
  3.1.1.4.4 Hox-D4 (HOX4B)   UniProt T UniProt UniProt  
  3.1.1.5 Subfamily: HOX5 TAATTA  
  3.1.1.5.1 Hox-A5 (HOX1C)   UniProt T00377 UniProt UniProt  
  3.1.1.5.2 Hox-B5 (HOX2A) UniProt T13933 UniProt UniProt  
  3.1.1.5.3 Hox-C5 (HOX3D)   UniProt T03351 UniProt UniProt  
  3.1.1.6 Subfamily: HOX6-7 TAATTA  
  3.1.1.6.1 Hox-A6 (HOX1B)   UniProt T03338 UniProt UniProt  
  3.1.1.6.2 Hox-B6 (HOX2B)   UniProt T01733 UniProt UniProt  
  3.1.1.6.3 Hox-C6 (HOX3C)   UniProt T25653 UniProt UniProt  
  3.1.1.6.3.1 Hox-C6, isoform 1 (PRII)   UniProt T01744  
  3.1.1.6.3.2 Hox-C6, isoform 2 (PRI)   UniProt T01743
  3.1.1.6.4 Hox-A7 (HOX1A)   UniProt T01278 UniProt UniProt  
  3.1.1.6.5 Hox-B7 (HOX2C)   UniProt T01735 UniProt UniProt  
  3.1.1.7 Subfamily: HOX8 GTAATTA  
  3.1.1.7.1 Hox-B8 (HOX2D)   UniProt T01737 UniProt UniProt  
  3.1.1.7.2 Hox-C8 (HOX3A)   UniProt T01749 UniProt UniProt  
  3.1.1.7.3 Hox-D8 (HOX4E) UniProt T UniProt UniProtF  
  3.1.1.8 Subfamily: HOX9-13 TCGTAAA  
  3.1.1.8.1 Hox-A9 (HOX1G)   UniProt T14354 UniProt UniProt PDB
  3.1.1.8.1.1 Hox-A9, isoform 1   UniProt T01710  
  3.1.1.8.1.2 Hox-A9, isoform 2 (T)   UniProt T04132  
  3.1.1.8.2 Hox-B9 (HOX2E)   UniProt T01739 UniProt UniProt  
  3.1.1.8.3 Hox-C9 (HOX3B)   UniProt T03349 UniProt UniProt PDB
  3.1.1.8.4 Hox-D9 (HOX4C) UniProt T01755 UniProt UniProt  
  3.1.1.8.5 Hox-A10 (HOX1H) UniProt T01715 UniProt UniProt  
  3.1.1.8.5.1 Hox-A10, isoform 1   UniProt T09504  
  3.1.1.8.5.2 Hox-A10, isoform 2   UniProt T09505  
  3.1.1.8.6 Hox-C10 (HOX3I) UniProt T03350 UniProt UniProt  
  3.1.1.8.7 Hox-D10 (HOX4D, HOX4E)   UniProt T01757 UniProt UniProt  
  3.1.1.8.8 Hox-A11 (HOX1I) UniProt T01717 UniProt UniProt  
  3.1.1.8.9 Hox-C11 (HOX3H) UniProt T03352 UniProt UniProt  
  3.1.1.8.10 Hox-D11 (HOX4F) UniProt T01760 UniProt  
  3.1.1.8.11 Hox-C12 (HOX3F) UniProt T03353 UniProt UniProt  
  3.1.1.8.12 Hox-D12 (HOX4H) UniProt T01763 UniProt UniProt  
  3.1.1.8.13 Hox-A13 (HOX1J) UniProt T03337 UniProt UniProtF PDB
  3.1.1.8.14 Hox-B13 UniProt T03802 UniProt UniProt PDB
  3.1.1.8.15 Hox-C13 (HOX3G) UniProt T03354 UniProt UniProt  
  3.1.1.8.16 Hox-D13 (HOX4I) UniProt T01765 UniProt UniProt  
  3.1.1.9 Subfamily: CDX (Caudal type homeobox) GGTAATAAA  
  3.1.1.9.1 CDX-1 UniProt T01999 UniProt UniProtF  
  3.1.1.9.2 CDX-2 (CDX-3)   UniProt T02002 UniProt UniProt  
  3.1.1.9.3 CDX-4   UniProt T03245 UniProt UniProt  
  3.1.1.10 Subfamily: EVX (Even-skipped homolog) CTAATTAG  
  3.1.1.10.1 EVX-1 UniProt T02023 UniProt UniProt  
  3.1.1.10.2 EVX-2 UniProt T16867 UniProt UniProt  
  3.1.1.11 Subfamily: GBX (Gastrulation brain homeobox) CTAATTAG  
  3.1.1.11.1 GBX-1 UniProt T16868 UniProt UniProt  
  3.1.1.11.2 GBX-2 UniProt T04020 UniProt UniProt  
  3.1.1.12 Subfamily: GSX TAATTA  
  3.1.1.12.1 GSX-1 (GSH-1) UniProt T05100 UniProt UniProt  
  3.1.1.12.2 GSX-2 (GSH-2) UniProt T17003 UniProt UniProt  
  3.1.1.13 Subfamily: MNX ACTAATTA  
  3.1.1.13.1 MNX1 (HB9, HLXB9) UniProt T03421 UniProt UniProt  
  3.1.1.14 Subfamily: MEOX TAATTA  
  3.1.1.14.1 MEOX-1 (MOX-1) UniProt T04047 UniProt UniProt  
  3.1.1.14.2 MEOX-2 (MOX-2) UniProt T04048 UniProt UniProt  
  3.1.1.15 Subfamily: PDX TAATTA  
  3.1.1.15.1 PDX-1 (IPF-1) UniProt T02057 UniProt UniProt PDB
  3.1.2 Family: NK-related factors    
  3.1.2.1 Subfamily: BARHL AACCAATTA  
  3.1.2.1.1 BarH-L1 UniProt T03920 UniProt UniProt PDB
  3.1.2.1.2 BarH-L2 UniProt T16779 UniProt UniProt  
  3.1.2.2 Subfamily: BARX TAATTA  
  3.1.2.2.1 BARX-1 UniProt T02403 UniProt UniProt  
  3.1.2.2.2 BARX-2   UniProt T11228 UniProt UniProt  
  3.1.2.3 Subfamily: BSX TAATTA  
  3.1.2.3.1 BSX-1 (BSX) UniProt T16798 UniProt UniProt  
  3.1.2.3.1.1 BSX-1, isoform 1 (Bsxla)   UniProt T16797  
  3.1.2.3.1.2 BSX-1, isoform 2 (Bsxlb)   UniProt T16800  
  3.1.2.4 Subfamily: DBX TTAATTA  
  3.1.2.4.1 DBX-1   UniProt T08090 UniProt UniProt  
  3.1.2.4.2 DBX-2   UniProt T08092 UniProt UniProt  
  3.1.2.5 Subfamily: DLX TAATTA  
  3.1.2.5.1 DLX-1 UniProt T02006 UniProt UniProt PDB
  3.1.2.5.2 DLX-2 UniProt T02009 UniProt UniProt  
  3.1.2.5.3 DLX-3 UniProt T02409 UniProt UniProt  
  3.1.2.5.4 DLX-4 UniProt T03993 UniProt UniProt  
  3.1.2.5.5 DLX-5 UniProt T03989 UniProt UniProt  
  3.1.2.5.5.1 DLX-5, isoform 1 (α)   UniProt T08471  
  3.1.2.5.5.2 DLX-5, isoform 2 (β)   UniProt T17006  
  3.1.2.5.5.3 DLX-5, isoform 3 (γ)   UniProt T17007  
  3.1.2.5.6 DLX-6 UniProt T03990 UniProt UniProtF  
  3.1.2.5.6.1 DLX-6, isoform 1   UniProt T14717  
  3.1.2.5.6.2 DLX-6, isoform 2   UniProt T26086  
  3.1.2.6 Subfamily: EMX CTAATTAG  
  3.1.2.6.1 EMX-1 UniProt T02011 UniProt UniProt  
  3.1.2.6.2 EMX-2 UniProt T02013 UniProt UniProt  
  3.1.2.7 Subfamily: EN (Engrailed-like factors) CTAATTAG  
  3.1.2.7.1 EN-1 UniProt T02016 UniProt UniProtF  
  3.1.2.7.2 EN-2 UniProt T02020 UniProt UniProt  
  3.1.2.8 Subfamily: HHEX ATTAA  
  3.1.2.8.1 HHEX (PRH)   UniProt T03417 UniProt UniProt  
  3.1.2.9 Subfamily: HLX TAATTAATTA  
  3.1.2.9.1 HLX-1 (HB24)   UniProt T02053 UniProt UniProt  
  3.1.2.10 Subfamily: LBX TTAATTAA  
  3.1.2.10.1 LBX-1   UniProt T04315 UniProt UniProt  
  3.1.2.10.2 LBX-2 UniProt T16903 UniProt UniProt  
  3.1.2.11 Subfamily: MSX ACCAATTA  
  3.1.2.11.1 MSX-1 (HOX7) UniProt T02072 UniProt UniProt PDB
  3.1.2.11.2 MSX-2 (HOX8) UniProt T02076 UniProt UniProt  
  3.1.2.12 Subfamily: NANOG CCATTT  
  3.1.2.12.1 NANOG   UniProt   UniProt UniProt PDB
  3.1.2.12.1.1 NANOG, isoform 1   UniProt    
  3.1.2.12.1.2 NANOG, isoform 2   UniProt    
  3.1.2.13 Subfamily: NK-1 CTAATTAG  
  3.1.2.13.1 NKX-1.1 (NKX1-1, SAX-2)   UniProt T16916 UniProt UniProt  
  3.1.2.13.2 NKX-1.2 (NKX1-2, SAX-1)   UniProt T16801 UniProt UniProt  
  3.1.2.14 Subfamily: NK-2.1 CCACTTGA  
  3.1.2.14.1 NKX-2.1 (NKX2-1, TTF-1)   UniProt T00859 UniProt UniProt PDB
  3.1.2.14.2 NKX-2.4 (NKX2-4, NK-2HD)   UniProt T16918 UniProt UniProt  
  3.1.2.15 Subfamily: NK-2.2 CCACTTGA  
  3.1.2.15.1 NKX-2.2 (NKX2-2, NKX2B)   UniProt T02384 UniProt UniProt  
  3.1.2.15.2 NKX-2.8 (NKX2-8, NKX2-9, NKX2G, NKX2H) UniProt T04338 UniProt UniProt  
  3.1.2.16 Subfamily: NK-3 AAGTACTT  
  3.1.2.16.1 NKX-3.1 (NKX3-1, NKX3A) UniProt T04256 UniProt UniProt PDB
  3.1.2.16.2 NKX-3.2 (NKX3-2, NKX3B) UniProt T02667 UniProt UniProtF  
  3.1.2.17 Subfamily: NK-4 CCACTTAA  
  3.1.2.17.1 NKX-2.3 (NKX2-3, NKX2C, NKX4-3) UniProt T04325 UniProt UniProt  
  3.1.2.17.2 NKX-2.5 (NKX2-5, NKX2E, NKX4-1, CSX)   UniProt T01675 UniProt UniProt PDB
  3.1.2.17.3 NKX-2.6 (NKX2-6, NKX2F, NKX4-2, CSX2)   UniProt T04342 UniProt UniProt  
  3.1.2.18 Subfamily: NK-5/HMX AGCAATTAA  
  3.1.2.18.1 HMX-1 (H6, NKX5-3, NKX-5.3) UniProt T04444 UniProt UniProt  
  3.1.2.18.2 HMX-2 (H6L, NKX5-2, NKX-5.2) UniProt T22946 UniProt UniProt  
  3.1.2.18.3 HMX-3 (NKX5-1, NKX-5.1) UniProt T04446 UniProt UniProt  
  3.1.2.19 Subfamily: NK-6 AATAATTA  
  3.1.2.19.1 NKX-6.1 (NKX6-1, NKX6A) UniProt T04269 UniProt UniProt  
  3.1.2.19.2 NKX-6.2 (NKX6-2, NKX6B) UniProt T02050 UniProt UniProt  
  3.1.2.19.3 NKX-6.3 (NKX6-3)   UniProt T16930 UniProt UniProt  
  3.1.2.20 Subfamily: NOTO    
  3.1.2.20.1 NOTO UniProt T19770 UniProt UniProt  
  3.1.2.21 Subfamily: TLX AATTAATA  
  3.1.2.21.1 TLX-1 (HOX11, TCL-3)   UniProt T02055 UniProt UniProt  
  3.1.2.21.2 TLX-2 (HOX11L1, NCX)   UniProt T04368 UniProt UniProt PDB
  3.1.2.21.3 TLX-3 (HOX11L2)   UniProt T04314 UniProt UniProt  
  3.1.2.22 Subfamily: VAX TAATTA  
  3.1.2.22.1 VAX-1 UniProt T03274 UniProt UniProt  
  3.1.2.22.1.1 VAX-1, isoform 1   UniProt T14527  
  3.1.2.22.1.2 VAX-1, isoform 2   UniProt T26350  
  3.1.2.22.2 VAX-2 UniProt T03276 UniProt UniProt  
  3.1.2.23 Subfamily: VENTX    
  3.1.3 Family: Paired-related HD factors    
  3.1.3.1 Subfamily: ALX TTAATTAA  
  3.1.3.1.1 ALX-1 (CART-1) UniProt T03999 UniProt UniProt  
  3.1.3.1.2 ALX-3 UniProt T03343 UniProt UniProt  
  3.1.3.1.3 ALX-4 UniProt T02967 UniProt UniProt  
  3.1.3.2 Subfamily: ARGFX    
  3.1.3.3 Subfamily: ARX TTAATTAA  
  3.1.3.3.1 ARX   UniProt T16770 UniProt UniProt  
  3.1.3.4 Subfamily: DMBX GGATTA  
  3.1.3.4.1 DMBX (MBX, OTX-3, PAXB) UniProt T06253 UniProt UniProt  
  3.1.3.4.1.1 DMBX, isoform 1   UniProt T11177  
  3.1.3.4.1.2 DMBX, isoform 2   UniProt T26087  
  3.1.3.5 Subfamily: DPRX    
  3.1.3.6 Subfamily: DRGX    
  3.1.3.6.1 DRGX (PRRXL1, Drg11) UniProt T19744 UniProt UniProt  
  3.1.3.6.1.1 DRGX, isoform 1   UniProt T25980  
  3.1.3.6.1.2 DRGX, isoform 2 (Prrxl1-B)   UniProt T19743  
  3.1.3.7 Subfamily: DUX TCTAATTGAGAATTAC  
  3.1.3.8 Subfamily: ESX TTAATTAA  
  3.1.3.9 Subfamily: GSC GGATTA  
  3.1.3.9.1 GSC UniProt T02047 UniProt UniProt  
  3.1.3.9.2 GSC-2 UniProt T04039 UniProt UniProt  
  3.1.3.10 Subfamily: HESX TAATTGAATTA  
  3.1.3.10.1 HESX-1 UniProt T02785 UniProt UniProt PDB
  3.1.3.11 Subfamily: HOPX    
  3.1.3.11.1 HOPX-1   UniProt T UniProt UniProt PDB
  3.1.3.12 Subfamily: ISX CTAATTAG  
  3.1.3.12.1 ISX UniProt T17019 UniProt UniProt  
  3.1.3.12.1.1 ISX, isoform 1   UniProt T17018  
  3.1.3.12.1.2 ISX, isoform 2   UniProt T26163  
  3.1.3.13 Subfamily: LEUTX    
  3.1.3.14 Subfamily: MIX    
  3.1.3.14.1 MIXL1 UniProt T04800 UniProt UniProt  
  3.1.3.15 Subfamily: NOBOX CTAATTAG  
  3.1.3.16 Subfamily: OTP TTAATTAA  
  3.1.3.16.1 OTP   UniProt T16920 UniProt UniProt  
  3.1.3.17 Subfamily: OTX GGGATTAA  
  3.1.3.17.1 OTX-1 UniProt T02080 UniProt UniProt  
  3.1.3.17.2 OTX-2 UniProt T02083 UniProt UniProt PDB
  3.1.3.17.3 CRX (CORD-2)   UniProt T03461 UniProt UniProt  
  3.1.3.18 Subfamily: PHOX ATAATTAA  
  3.1.3.18.1 PHOX-2A (ARIX, PMX2A) UniProt T02090 UniProt UniProt  
  3.1.3.18.2 PHOX-2B (PMX2B) UniProt T03976 UniProt UniProt  
  3.1.3.19 Subfamily: PITX GGGATTAA  
  3.1.3.19.1 PITX-1 (BFT, PTX1) UniProt T02415 UniProt UniProt  
  3.1.3.19.2 PITX-2 (ARP, RGS, RIEG1, Ptx2)   UniProt T09186 UniProt UniProt PDB
  3.1.3.19.2.1 Ptx2A   UniProt T02410  
  3.1.3.19.2.2 Ptx2B   UniProt T02412  
  3.1.3.19.2.3 Ptx2C   UniProt T17005  
  3.1.3.19.2.4 Ptx2Cα   UniProt T25959  
  3.1.3.19.2.5 Ptx2Cβ   UniProt T25960  
  3.1.3.19.3 PITX-3 (PTX3) UniProt T02666 UniProt UniProt  
  3.1.3.20 Subfamily: PROP TTAATTAA  
  3.1.3.20.1 PROP-1 UniProt T UniProt UniProt  
  3.1.3.21 Subfamily: PRRX GCTAATTAGC  
  3.1.3.21.1 PRRX-1 (PHOX1, PMX1) UniProt T02966 UniProt UniProt  
  3.1.3.21.1.1 PRRX-1, isoform 1 (K2-a)   UniProt T02060  
  3.1.3.21.1.2 PRRX-1, isoform 2 (K2-b)   UniProt T02061  
  3.1.3.21.2 PRRX-2 (PMX2, PRX2) UniProt T01483 UniProt UniProt  
  3.1.3.22 Subfamily: RAX CTAATTAG  
  3.1.3.22.1 RAX (RX) UniProt T03502 UniProt UniProt  
  3.1.3.23 Subfamily: RHOX CTAATTAG  
  3.1.3.24 Subfamily: SEBOX    
  3.1.3.24.1 SEBOX (OG-9)   UniProt T03309 UniProt UniProt  
  3.1.3.25 Subfamily: SHOX TTAATTAA  
  3.1.3.25.2 SHOX-2 (OG-12X, SHOT) UniProt T14734 UniProt UniProt  
  3.1.3.25.2.1 SHOX-2, isoform 1 (OG12A)   UniProt T03310  
  3.1.3.25.2.2 SHOX-2, isoform 2 (OG12B)   UniProt T26289  
  3.1.3.26 Subfamily: TPRX    
  3.1.3.27 Subfamily: UNCX TTAATTAA  
  3.1.3.27.1 UNCX (Uncx4.1) UniProt T03307 UniProt UniProt  
  3.1.3.28 Subfamily: VSX TTAATTAA  
  3.1.3.28.1 VSX-1 (RINX) UniProt T16785 UniProt UniProt  
  3.1.3.28.2 VSX-2 (HOX10) UniProt T02970 UniProt UniProt  
  3.1.4 Family: TALE-type homeo domain factors    
  3.1.4.1 Subfamily: IRX (Iroquois) TACATGTA  
  3.1.4.1.1 IRX-1   UniProt T04281 UniProt UniProt  
  3.1.4.1.2 IRX-2 UniProt T14754 UniProt UniProt  
  3.1.4.1.3 IRX-3 UniProt T02439 UniProt UniProt  
  3.1.4.1.3.1 IRX-3, isoform 1   UniProt T11255  
  3.1.4.1.3.2 IRX-3, isoform 2   UniProt T26162  
  3.1.4.1.4 IRX-4   UniProt T04276 UniProt UniProt  
  3.1.4.1.5 IRX-5 UniProt T04283 UniProt UniProt  
  3.1.4.1.6 IRX-6   UniProt T08164 UniProt UniProt  
  3.1.4.2 Subfamily: MEIS AGCTGTCAA  
  3.1.4.2.1 Meis1 UniProt T09993 UniProt UniProt  
  3.1.4.2.1.1 Meis1, isoform 1 (Meis1A)   UniProt T03388  
  3.1.4.2.1.2 Meis1, isoform 2 (Meis1B)   UniProt T03389  
  3.1.4.2.1.3 Meis1, isoform 3   UniProt T26190  
  3.1.4.2.2 Meis2 UniProt T11160 UniProt UniProt PDB
  3.1.4.2.2.1 Meis2A   UniProt T03405  
  3.1.4.2.2.2 Meis2B   UniProt T03407  
  3.1.4.2.2.3 Meis2C   UniProt T03408  
  3.1.4.2.2.4 Meis2D   UniProt T03409  
  3.1.4.2.3 Meis3 UniProt T03406 UniProt UniProt  
  3.1.4.2.3.1 Meis3, isoform 1   UniProt T11188  
  3.1.4.2.3.2 Meis3, isoform 2   UniProt T25908  
  3.1.4.3 Subfamily: MKX (Mohawk)    
  3.1.4.3.1 MKX (IRX-L1)   UniProt T UniProt UniProt  
  3.1.4.4 Subfamily: PBX CATCAAT  
  3.1.4.4.1 PBX-1   UniProt T08131 UniProt UniProt PDB
  3.1.4.4.1.1 PBX-1a   UniProt T03451  
  3.1.4.4.1.2 PBX-1b   UniProt T02088  
  3.1.4.4.2 PBX-2   UniProt T04127 UniProt UniProt  
  3.1.4.4.3 PBX-3   UniProt T14296 UniProt UniProt  
  3.1.4.4.3.1 PBX-3a   UniProt T04125  
  3.1.4.4.3.2 PBX-3b   UniProt T04126  
  3.1.4.4.4 PBX-4   UniProt T19780 UniProt UniProt  
  3.1.4.4.4.1 PBX-4, isoform 1   UniProt T19779  
  3.1.4.4.4.2 PBX-4, isoform 2   UniProt T19781  
  3.1.4.5 Subfamily: PKNOX ACCTGTCAAT  
  3.1.4.5.1 PKNOX-1 (PREP-1) UniProt T04121 UniProt UniProt PDB
  3.1.4.5.2 PKNOX-2 (PREP-2) UniProt T16934 UniProt UniProt  
  3.1.4.6 Subfamily: TGIF AGCTGTCAAT  
  3.1.4.6.1 TGIF-1 UniProt T04077 UniProt UniProt PDB
  3.1.4.6.1.1 TGIF-1, isoform 1   UniProt T10218  
  3.1.4.6.1.2 TGIF-1, isoform 2   UniProt T17016  
  3.1.4.6.2 TGIF-2 UniProt T16763 UniProt UniProt  
  3.1.4.6.3 TGIF-2LX UniProt T UniProt UniProt PDB
  3.1.5 Family: HD-LIM factors AATTAA;  
  3.1.5.1 Subfamily: ISL ATCAATTAA  
  3.1.5.1.1 ISL-1 (Islet-1)   UniProt T09161 UniProt UniProt  
  3.1.5.1.1.1 ISL-1, isoform 1 (α)   UniProt T06054  
  3.1.5.1.1.2 ISL-1, isoform 2 (β)   UniProt T06055  
  3.1.5.1.2 ISL-2 (Islet-2) UniProt T16901 UniProt UniProt  
  3.1.5.2 Subfamily: Lhx-1-like factors TTAATTAA  
  3.1.5.2.1 Lhx1 (Lim-1)   UniProt T01961 UniProt UniProt  
  3.1.5.2.2 Lhx5   UniProt T04181 UniProt UniProt  
  3.1.5.3 Subfamily: Lhx-2-like factors TAATTA  
  3.1.5.3.1 Lhx2 (LH-2) UniProt T01969 UniProt UniProt  
  3.1.5.3.2 Lhx9 UniProt T11357 UniProt UniProt PDB
  3.1.5.3.2.1 Lhx9, isoform 1 β   UniProt T04192  
  3.1.5.3.2.2 Lhx9, isoform 2 α   UniProt T04195  
  3.1.5.3.2.3 Lhx9, isoform 3   UniProt T25470  
  3.1.5.3.2.4 Lhx9, isoform 4   UniProt T26174  
  3.1.5.4 Subfamily: Lhx-3-like factors TAATTA  
  3.1.5.4.1 Lhx3   UniProt T10879 UniProt UniProt  
  3.1.5.4.1.1 Lhx3, isoform A   UniProt T01964  
  3.1.5.4.1.2 Lhx3, isoform B   UniProt T04840  
  3.1.5.4.2 Lhx4 UniProt T03542 UniProt UniProt  
  3.1.5.5 Subfamily: Lhx-6-like factors CTAATTAG  
  3.1.5.5.1 Lhx6 (Lhx6.1) UniProt T05162 UniProt UniProt  
  3.1.5.5.1.1 Lhx6, isoform 1 (Lhx6.1a)   UniProt T04187  
  3.1.5.5.1.2 Lhx6, isoform 2 (Lhx6.1b)   UniProt T04188  
  3.1.5.5.2 Lhx8 UniProt T11354 UniProt UniProt  
  3.1.5.6 Subfamily: Lmx TTAATTAA  
  3.1.5.6.1 Lmx-1α (LMX-1.1, LMX1A) UniProt T04300 UniProt UniProt  
  3.1.5.6.2 Lmx-1β (LMX-1.2, LMX1B) UniProt T04303 UniProt UniProt  
  3.1.6 Family: HD-SINE factors GGTATCA  
  3.1.6.1 Subfamily: SIX1-like factors GGGTATCA  
  3.1.6.1.1 SIX1   UniProt T03262 UniProt  
  3.1.6.1.2 SIX2   UniProt T03261 UniProt UniProt  
  3.1.6.2 Subfamily: SIX3-like factors GGGTATCA  
  3.1.6.2.1 SIX3